ID: 1075653649

View in Genome Browser
Species Human (GRCh38)
Location 10:124147005-124147027
Sequence CAAGTGGCTGACATTGCTAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075653642_1075653649 13 Left 1075653642 10:124146969-124146991 CCCCTGGCTAAGGGCCTGGTCTA No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653637_1075653649 28 Left 1075653637 10:124146954-124146976 CCTCCTCTGAAATAGCCCCTGGC No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653638_1075653649 25 Left 1075653638 10:124146957-124146979 CCTCTGAAATAGCCCCTGGCTAA No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653646_1075653649 -1 Left 1075653646 10:124146983-124147005 CCTGGTCTATGCAGGTGTTCACC No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653643_1075653649 12 Left 1075653643 10:124146970-124146992 CCCTGGCTAAGGGCCTGGTCTAT No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data
1075653644_1075653649 11 Left 1075653644 10:124146971-124146993 CCTGGCTAAGGGCCTGGTCTATG No data
Right 1075653649 10:124147005-124147027 CAAGTGGCTGACATTGCTAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075653649 Original CRISPR CAAGTGGCTGACATTGCTAG TGG Intergenic
No off target data available for this crispr