ID: 1075654058

View in Genome Browser
Species Human (GRCh38)
Location 10:124149751-124149773
Sequence TAGCAGCCACAATAGGAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075654058_1075654066 21 Left 1075654058 10:124149751-124149773 CCTAGCTCCTATTGTGGCTGCTA No data
Right 1075654066 10:124149795-124149817 GCTGAAGGGCTGGCAAGAGGAGG No data
1075654058_1075654067 22 Left 1075654058 10:124149751-124149773 CCTAGCTCCTATTGTGGCTGCTA No data
Right 1075654067 10:124149796-124149818 CTGAAGGGCTGGCAAGAGGAGGG No data
1075654058_1075654065 18 Left 1075654058 10:124149751-124149773 CCTAGCTCCTATTGTGGCTGCTA No data
Right 1075654065 10:124149792-124149814 CCTGCTGAAGGGCTGGCAAGAGG No data
1075654058_1075654060 6 Left 1075654058 10:124149751-124149773 CCTAGCTCCTATTGTGGCTGCTA No data
Right 1075654060 10:124149780-124149802 AAGCTAAACCAACCTGCTGAAGG No data
1075654058_1075654061 7 Left 1075654058 10:124149751-124149773 CCTAGCTCCTATTGTGGCTGCTA No data
Right 1075654061 10:124149781-124149803 AGCTAAACCAACCTGCTGAAGGG No data
1075654058_1075654062 11 Left 1075654058 10:124149751-124149773 CCTAGCTCCTATTGTGGCTGCTA No data
Right 1075654062 10:124149785-124149807 AAACCAACCTGCTGAAGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075654058 Original CRISPR TAGCAGCCACAATAGGAGCT AGG (reversed) Intergenic
No off target data available for this crispr