ID: 1075654441

View in Genome Browser
Species Human (GRCh38)
Location 10:124152067-124152089
Sequence GCCTCTTTCTTGCCTGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075654441_1075654446 3 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654446 10:124152093-124152115 GCCCTGCTCCTGGCTTCCGCTGG No data
1075654441_1075654454 12 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654454 10:124152102-124152124 CTGGCTTCCGCTGGGCGGTGGGG No data
1075654441_1075654444 -7 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654444 10:124152083-124152105 AAGAGGCCAGGCCCTGCTCCTGG No data
1075654441_1075654455 13 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654455 10:124152103-124152125 TGGCTTCCGCTGGGCGGTGGGGG No data
1075654441_1075654451 10 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654451 10:124152100-124152122 TCCTGGCTTCCGCTGGGCGGTGG No data
1075654441_1075654458 20 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654458 10:124152110-124152132 CGCTGGGCGGTGGGGGTCCTGGG No data
1075654441_1075654453 11 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654453 10:124152101-124152123 CCTGGCTTCCGCTGGGCGGTGGG No data
1075654441_1075654457 19 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654457 10:124152109-124152131 CCGCTGGGCGGTGGGGGTCCTGG No data
1075654441_1075654448 4 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654448 10:124152094-124152116 CCCTGCTCCTGGCTTCCGCTGGG No data
1075654441_1075654450 7 Left 1075654441 10:124152067-124152089 CCAGAACCAGGCAAGAAAGAGGC No data
Right 1075654450 10:124152097-124152119 TGCTCCTGGCTTCCGCTGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075654441 Original CRISPR GCCTCTTTCTTGCCTGGTTC TGG (reversed) Intergenic
No off target data available for this crispr