ID: 1075655179

View in Genome Browser
Species Human (GRCh38)
Location 10:124156508-124156530
Sequence GATCCAAGCTGCAGGGGGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075655170_1075655179 7 Left 1075655170 10:124156478-124156500 CCAATTCACAGACTCCCGGAGGG No data
Right 1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG No data
1075655173_1075655179 -8 Left 1075655173 10:124156493-124156515 CCGGAGGGTTTAGCCGATCCAAG No data
Right 1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG No data
1075655166_1075655179 30 Left 1075655166 10:124156455-124156477 CCCTGGGTATCAGCTCTGTGGGA No data
Right 1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG No data
1075655167_1075655179 29 Left 1075655167 10:124156456-124156478 CCTGGGTATCAGCTCTGTGGGAC No data
Right 1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG No data
1075655172_1075655179 -7 Left 1075655172 10:124156492-124156514 CCCGGAGGGTTTAGCCGATCCAA No data
Right 1075655179 10:124156508-124156530 GATCCAAGCTGCAGGGGGTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075655179 Original CRISPR GATCCAAGCTGCAGGGGGTT CGG Intergenic
No off target data available for this crispr