ID: 1075656721

View in Genome Browser
Species Human (GRCh38)
Location 10:124166707-124166729
Sequence TTGGCTACACAGGCCCACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075656715_1075656721 -6 Left 1075656715 10:124166690-124166712 CCCACTGTGGCCTTCCCTTGGCT No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data
1075656716_1075656721 -7 Left 1075656716 10:124166691-124166713 CCACTGTGGCCTTCCCTTGGCTA No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data
1075656711_1075656721 1 Left 1075656711 10:124166683-124166705 CCCACCGCCCACTGTGGCCTTCC No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data
1075656713_1075656721 -3 Left 1075656713 10:124166687-124166709 CCGCCCACTGTGGCCTTCCCTTG No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data
1075656709_1075656721 9 Left 1075656709 10:124166675-124166697 CCTAAGCTCCCACCGCCCACTGT No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data
1075656708_1075656721 24 Left 1075656708 10:124166660-124166682 CCGCTCTAACGCAGGCCTAAGCT No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data
1075656712_1075656721 0 Left 1075656712 10:124166684-124166706 CCACCGCCCACTGTGGCCTTCCC No data
Right 1075656721 10:124166707-124166729 TTGGCTACACAGGCCCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075656721 Original CRISPR TTGGCTACACAGGCCCACCT TGG Intergenic
No off target data available for this crispr