ID: 1075657144

View in Genome Browser
Species Human (GRCh38)
Location 10:124169461-124169483
Sequence CTCCGACAACCCTCCAATTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075657144_1075657155 30 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657155 10:124169514-124169536 CGAGAGGAGGAGGCAGGCATAGG No data
1075657144_1075657153 24 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657153 10:124169508-124169530 GGACACCGAGAGGAGGAGGCAGG No data
1075657144_1075657150 17 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657150 10:124169501-124169523 GCCAAAGGGACACCGAGAGGAGG No data
1075657144_1075657148 3 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657148 10:124169487-124169509 TGGAATCTGCAGACGCCAAAGGG No data
1075657144_1075657147 2 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657147 10:124169486-124169508 TTGGAATCTGCAGACGCCAAAGG No data
1075657144_1075657149 14 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657149 10:124169498-124169520 GACGCCAAAGGGACACCGAGAGG No data
1075657144_1075657152 20 Left 1075657144 10:124169461-124169483 CCATAATTGGAGGGTTGTCGGAG No data
Right 1075657152 10:124169504-124169526 AAAGGGACACCGAGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075657144 Original CRISPR CTCCGACAACCCTCCAATTA TGG (reversed) Intergenic
No off target data available for this crispr