ID: 1075657219

View in Genome Browser
Species Human (GRCh38)
Location 10:124169903-124169925
Sequence GGGCTGAGGGTACCACAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075657219_1075657226 -5 Left 1075657219 10:124169903-124169925 CCCACCTGTGGTACCCTCAGCCC No data
Right 1075657226 10:124169921-124169943 AGCCCAGGTAAGGTCTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075657219 Original CRISPR GGGCTGAGGGTACCACAGGT GGG (reversed) Intergenic
No off target data available for this crispr