ID: 1075658484

View in Genome Browser
Species Human (GRCh38)
Location 10:124176986-124177008
Sequence GCTCTTGGTGCAGGGCTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075658476_1075658484 19 Left 1075658476 10:124176944-124176966 CCAGGGCGAGTGGGCAGGACGGA No data
Right 1075658484 10:124176986-124177008 GCTCTTGGTGCAGGGCTCCTTGG No data
1075658478_1075658484 -4 Left 1075658478 10:124176967-124176989 CCGTGCTAACCCAGGAGCAGCTC No data
Right 1075658484 10:124176986-124177008 GCTCTTGGTGCAGGGCTCCTTGG No data
1075658474_1075658484 20 Left 1075658474 10:124176943-124176965 CCCAGGGCGAGTGGGCAGGACGG No data
Right 1075658484 10:124176986-124177008 GCTCTTGGTGCAGGGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075658484 Original CRISPR GCTCTTGGTGCAGGGCTCCT TGG Intergenic