ID: 1075658688

View in Genome Browser
Species Human (GRCh38)
Location 10:124178381-124178403
Sequence CAGAATCCCCAGGTGGTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075658681_1075658688 19 Left 1075658681 10:124178339-124178361 CCTTCTTGCTGTGGGAGCTTTCT No data
Right 1075658688 10:124178381-124178403 CAGAATCCCCAGGTGGTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075658688 Original CRISPR CAGAATCCCCAGGTGGTGCA GGG Intergenic
No off target data available for this crispr