ID: 1075664770

View in Genome Browser
Species Human (GRCh38)
Location 10:124222472-124222494
Sequence GCCAACTCCTCCTCAAGGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664770_1075664779 17 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG No data
1075664770_1075664781 21 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664770_1075664778 16 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data
1075664770_1075664772 -2 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664772 10:124222493-124222515 GCCCAGTTCCAGCAGCCCTCAGG No data
1075664770_1075664780 18 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664780 10:124222513-124222535 AGGCTGCTCACAGTCCAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664770 Original CRISPR GCCAACTCCTCCTCAAGGCT TGG (reversed) Intergenic
No off target data available for this crispr