ID: 1075664771

View in Genome Browser
Species Human (GRCh38)
Location 10:124222477-124222499
Sequence ACTGGGCCAACTCCTCCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664771_1075664779 12 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG No data
1075664771_1075664784 29 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664771_1075664772 -7 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664772 10:124222493-124222515 GCCCAGTTCCAGCAGCCCTCAGG No data
1075664771_1075664781 16 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664771_1075664783 28 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664783 10:124222528-124222550 CAGTGGGGAGGCCTGAGCGTAGG No data
1075664771_1075664780 13 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664780 10:124222513-124222535 AGGCTGCTCACAGTCCAGTGGGG No data
1075664771_1075664778 11 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664771 Original CRISPR ACTGGGCCAACTCCTCCTCA AGG (reversed) Intergenic