ID: 1075664773

View in Genome Browser
Species Human (GRCh38)
Location 10:124222494-124222516
Sequence GCCTGAGGGCTGCTGGAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664773_1075664789 27 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664789 10:124222544-124222566 GCGTAGGGCCAGGTGGCCCAGGG No data
1075664773_1075664778 -6 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data
1075664773_1075664780 -4 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664780 10:124222513-124222535 AGGCTGCTCACAGTCCAGTGGGG No data
1075664773_1075664781 -1 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664773_1075664783 11 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664783 10:124222528-124222550 CAGTGGGGAGGCCTGAGCGTAGG No data
1075664773_1075664786 20 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664786 10:124222537-124222559 GGCCTGAGCGTAGGGCCAGGTGG No data
1075664773_1075664785 17 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664785 10:124222534-124222556 GGAGGCCTGAGCGTAGGGCCAGG No data
1075664773_1075664784 12 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664773_1075664788 26 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664788 10:124222543-124222565 AGCGTAGGGCCAGGTGGCCCAGG No data
1075664773_1075664779 -5 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664779 10:124222512-124222534 CAGGCTGCTCACAGTCCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664773 Original CRISPR GCCTGAGGGCTGCTGGAACT GGG (reversed) Intergenic
No off target data available for this crispr