ID: 1075664778

View in Genome Browser
Species Human (GRCh38)
Location 10:124222511-124222533
Sequence TCAGGCTGCTCACAGTCCAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664771_1075664778 11 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data
1075664770_1075664778 16 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data
1075664774_1075664778 -7 Left 1075664774 10:124222495-124222517 CCAGTTCCAGCAGCCCTCAGGCT No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data
1075664773_1075664778 -6 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data
1075664768_1075664778 22 Left 1075664768 10:124222466-124222488 CCACAACCAAGCCTTGAGGAGGA No data
Right 1075664778 10:124222511-124222533 TCAGGCTGCTCACAGTCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664778 Original CRISPR TCAGGCTGCTCACAGTCCAG TGG Intergenic
No off target data available for this crispr