ID: 1075664781

View in Genome Browser
Species Human (GRCh38)
Location 10:124222516-124222538
Sequence CTGCTCACAGTCCAGTGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664773_1075664781 -1 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664771_1075664781 16 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664774_1075664781 -2 Left 1075664774 10:124222495-124222517 CCAGTTCCAGCAGCCCTCAGGCT No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664770_1075664781 21 Left 1075664770 10:124222472-124222494 CCAAGCCTTGAGGAGGAGTTGGC No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664768_1075664781 27 Left 1075664768 10:124222466-124222488 CCACAACCAAGCCTTGAGGAGGA No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data
1075664775_1075664781 -8 Left 1075664775 10:124222501-124222523 CCAGCAGCCCTCAGGCTGCTCAC No data
Right 1075664781 10:124222516-124222538 CTGCTCACAGTCCAGTGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664781 Original CRISPR CTGCTCACAGTCCAGTGGGG AGG Intergenic
No off target data available for this crispr