ID: 1075664784

View in Genome Browser
Species Human (GRCh38)
Location 10:124222529-124222551
Sequence AGTGGGGAGGCCTGAGCGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664777_1075664784 -3 Left 1075664777 10:124222509-124222531 CCTCAGGCTGCTCACAGTCCAGT No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664776_1075664784 -2 Left 1075664776 10:124222508-124222530 CCCTCAGGCTGCTCACAGTCCAG No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664773_1075664784 12 Left 1075664773 10:124222494-124222516 CCCAGTTCCAGCAGCCCTCAGGC No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664775_1075664784 5 Left 1075664775 10:124222501-124222523 CCAGCAGCCCTCAGGCTGCTCAC No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664771_1075664784 29 Left 1075664771 10:124222477-124222499 CCTTGAGGAGGAGTTGGCCCAGT No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data
1075664774_1075664784 11 Left 1075664774 10:124222495-124222517 CCAGTTCCAGCAGCCCTCAGGCT No data
Right 1075664784 10:124222529-124222551 AGTGGGGAGGCCTGAGCGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664784 Original CRISPR AGTGGGGAGGCCTGAGCGTA GGG Intergenic
No off target data available for this crispr