ID: 1075664790

View in Genome Browser
Species Human (GRCh38)
Location 10:124222548-124222570
Sequence AGGGCCAGGTGGCCCAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075664776_1075664790 17 Left 1075664776 10:124222508-124222530 CCCTCAGGCTGCTCACAGTCCAG No data
Right 1075664790 10:124222548-124222570 AGGGCCAGGTGGCCCAGGGAAGG No data
1075664774_1075664790 30 Left 1075664774 10:124222495-124222517 CCAGTTCCAGCAGCCCTCAGGCT No data
Right 1075664790 10:124222548-124222570 AGGGCCAGGTGGCCCAGGGAAGG No data
1075664777_1075664790 16 Left 1075664777 10:124222509-124222531 CCTCAGGCTGCTCACAGTCCAGT No data
Right 1075664790 10:124222548-124222570 AGGGCCAGGTGGCCCAGGGAAGG No data
1075664782_1075664790 -2 Left 1075664782 10:124222527-124222549 CCAGTGGGGAGGCCTGAGCGTAG No data
Right 1075664790 10:124222548-124222570 AGGGCCAGGTGGCCCAGGGAAGG No data
1075664775_1075664790 24 Left 1075664775 10:124222501-124222523 CCAGCAGCCCTCAGGCTGCTCAC No data
Right 1075664790 10:124222548-124222570 AGGGCCAGGTGGCCCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075664790 Original CRISPR AGGGCCAGGTGGCCCAGGGA AGG Intergenic
No off target data available for this crispr