ID: 1075667671

View in Genome Browser
Species Human (GRCh38)
Location 10:124242674-124242696
Sequence CAGGGGAAACAGAGGGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075667659_1075667671 9 Left 1075667659 10:124242642-124242664 CCCTCGTGCAGATCAAAGATGCC No data
Right 1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG No data
1075667660_1075667671 8 Left 1075667660 10:124242643-124242665 CCTCGTGCAGATCAAAGATGCCG No data
Right 1075667671 10:124242674-124242696 CAGGGGAAACAGAGGGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075667671 Original CRISPR CAGGGGAAACAGAGGGGGAA GGG Intergenic
No off target data available for this crispr