ID: 1075672175

View in Genome Browser
Species Human (GRCh38)
Location 10:124270303-124270325
Sequence TTGGGGAAGGTGAGGCTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075672175_1075672187 9 Left 1075672175 10:124270303-124270325 CCCTCCAGCCTCACCTTCCCCAA No data
Right 1075672187 10:124270335-124270357 GAAATCCTCCTCCGCCTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075672175 Original CRISPR TTGGGGAAGGTGAGGCTGGA GGG (reversed) Intergenic
No off target data available for this crispr