ID: 1075674431

View in Genome Browser
Species Human (GRCh38)
Location 10:124286529-124286551
Sequence ATCTGTGAGGGGCCACCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075674431_1075674437 17 Left 1075674431 10:124286529-124286551 CCCTGGGGTGGCCCCTCACAGAT No data
Right 1075674437 10:124286569-124286591 AAAACCGAGGCACAGAGAGATGG No data
1075674431_1075674436 4 Left 1075674431 10:124286529-124286551 CCCTGGGGTGGCCCCTCACAGAT No data
Right 1075674436 10:124286556-124286578 GCATCAAATCTGCAAAACCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075674431 Original CRISPR ATCTGTGAGGGGCCACCCCA GGG (reversed) Intergenic