ID: 1075676556

View in Genome Browser
Species Human (GRCh38)
Location 10:124299949-124299971
Sequence CAGCCTCCTGCCACCCACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075676552_1075676556 -3 Left 1075676552 10:124299929-124299951 CCCAGGCAGAACCAAGGCACCAG No data
Right 1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG No data
1075676553_1075676556 -4 Left 1075676553 10:124299930-124299952 CCAGGCAGAACCAAGGCACCAGC No data
Right 1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG No data
1075676549_1075676556 13 Left 1075676549 10:124299913-124299935 CCCAGGCTTGCATCTGCCCAGGC No data
Right 1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG No data
1075676550_1075676556 12 Left 1075676550 10:124299914-124299936 CCAGGCTTGCATCTGCCCAGGCA No data
Right 1075676556 10:124299949-124299971 CAGCCTCCTGCCACCCACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075676556 Original CRISPR CAGCCTCCTGCCACCCACCA AGG Intergenic
No off target data available for this crispr