ID: 1075677746

View in Genome Browser
Species Human (GRCh38)
Location 10:124307998-124308020
Sequence CTGTGTCTGGGGAAGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075677737_1075677746 -5 Left 1075677737 10:124307980-124308002 CCCCTCGTAAAGCCTTGCCTGTG No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data
1075677732_1075677746 26 Left 1075677732 10:124307949-124307971 CCCTTCTGCCAGGGCTCAGCAGA No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data
1075677738_1075677746 -6 Left 1075677738 10:124307981-124308003 CCCTCGTAAAGCCTTGCCTGTGT No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data
1075677733_1075677746 25 Left 1075677733 10:124307950-124307972 CCTTCTGCCAGGGCTCAGCAGAG No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data
1075677735_1075677746 18 Left 1075677735 10:124307957-124307979 CCAGGGCTCAGCAGAGGTGTGAC No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data
1075677736_1075677746 -4 Left 1075677736 10:124307979-124308001 CCCCCTCGTAAAGCCTTGCCTGT No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data
1075677739_1075677746 -7 Left 1075677739 10:124307982-124308004 CCTCGTAAAGCCTTGCCTGTGTC No data
Right 1075677746 10:124307998-124308020 CTGTGTCTGGGGAAGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075677746 Original CRISPR CTGTGTCTGGGGAAGGTGTC AGG Intergenic
No off target data available for this crispr