ID: 1075680160

View in Genome Browser
Species Human (GRCh38)
Location 10:124325768-124325790
Sequence CAGAGTGACGGGAGCAGTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075680160_1075680170 18 Left 1075680160 10:124325768-124325790 CCCACACTGCTCCCGTCACTCTG No data
Right 1075680170 10:124325809-124325831 GCTTGTCTGTCTCCCTCTCCAGG No data
1075680160_1075680171 24 Left 1075680160 10:124325768-124325790 CCCACACTGCTCCCGTCACTCTG No data
Right 1075680171 10:124325815-124325837 CTGTCTCCCTCTCCAGGCTGTGG No data
1075680160_1075680168 -4 Left 1075680160 10:124325768-124325790 CCCACACTGCTCCCGTCACTCTG No data
Right 1075680168 10:124325787-124325809 TCTGGGAGGGAAGAGCCTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075680160 Original CRISPR CAGAGTGACGGGAGCAGTGT GGG (reversed) Intergenic
No off target data available for this crispr