ID: 1075682412

View in Genome Browser
Species Human (GRCh38)
Location 10:124342235-124342257
Sequence AGAGCTTCAGGTGGGTCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075682412_1075682423 19 Left 1075682412 10:124342235-124342257 CCCAGTGACCCACCTGAAGCTCT No data
Right 1075682423 10:124342277-124342299 ATCTCCAGCCCCGCAGGGTAGGG No data
1075682412_1075682418 -6 Left 1075682412 10:124342235-124342257 CCCAGTGACCCACCTGAAGCTCT No data
Right 1075682418 10:124342252-124342274 AGCTCTGCTGCCGGCAGAGACGG No data
1075682412_1075682420 13 Left 1075682412 10:124342235-124342257 CCCAGTGACCCACCTGAAGCTCT No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data
1075682412_1075682422 18 Left 1075682412 10:124342235-124342257 CCCAGTGACCCACCTGAAGCTCT No data
Right 1075682422 10:124342276-124342298 GATCTCCAGCCCCGCAGGGTAGG No data
1075682412_1075682421 14 Left 1075682412 10:124342235-124342257 CCCAGTGACCCACCTGAAGCTCT No data
Right 1075682421 10:124342272-124342294 CGGAGATCTCCAGCCCCGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075682412 Original CRISPR AGAGCTTCAGGTGGGTCACT GGG (reversed) Intergenic
No off target data available for this crispr