ID: 1075682417

View in Genome Browser
Species Human (GRCh38)
Location 10:124342247-124342269
Sequence TCTGCCGGCAGCAGAGCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075682417_1075682428 20 Left 1075682417 10:124342247-124342269 CCTGAAGCTCTGCTGCCGGCAGA No data
Right 1075682428 10:124342290-124342312 CAGGGTAGGGCTGTCTACACTGG No data
1075682417_1075682422 6 Left 1075682417 10:124342247-124342269 CCTGAAGCTCTGCTGCCGGCAGA No data
Right 1075682422 10:124342276-124342298 GATCTCCAGCCCCGCAGGGTAGG No data
1075682417_1075682423 7 Left 1075682417 10:124342247-124342269 CCTGAAGCTCTGCTGCCGGCAGA No data
Right 1075682423 10:124342277-124342299 ATCTCCAGCCCCGCAGGGTAGGG No data
1075682417_1075682421 2 Left 1075682417 10:124342247-124342269 CCTGAAGCTCTGCTGCCGGCAGA No data
Right 1075682421 10:124342272-124342294 CGGAGATCTCCAGCCCCGCAGGG No data
1075682417_1075682420 1 Left 1075682417 10:124342247-124342269 CCTGAAGCTCTGCTGCCGGCAGA No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075682417 Original CRISPR TCTGCCGGCAGCAGAGCTTC AGG (reversed) Intergenic
No off target data available for this crispr