ID: 1075682420

View in Genome Browser
Species Human (GRCh38)
Location 10:124342271-124342293
Sequence ACGGAGATCTCCAGCCCCGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075682417_1075682420 1 Left 1075682417 10:124342247-124342269 CCTGAAGCTCTGCTGCCGGCAGA No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data
1075682412_1075682420 13 Left 1075682412 10:124342235-124342257 CCCAGTGACCCACCTGAAGCTCT No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data
1075682414_1075682420 5 Left 1075682414 10:124342243-124342265 CCCACCTGAAGCTCTGCTGCCGG No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data
1075682416_1075682420 4 Left 1075682416 10:124342244-124342266 CCACCTGAAGCTCTGCTGCCGGC No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data
1075682413_1075682420 12 Left 1075682413 10:124342236-124342258 CCAGTGACCCACCTGAAGCTCTG No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data
1075682411_1075682420 22 Left 1075682411 10:124342226-124342248 CCACTCATGCCCAGTGACCCACC No data
Right 1075682420 10:124342271-124342293 ACGGAGATCTCCAGCCCCGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075682420 Original CRISPR ACGGAGATCTCCAGCCCCGC AGG Intergenic
No off target data available for this crispr