ID: 1075685691

View in Genome Browser
Species Human (GRCh38)
Location 10:124363868-124363890
Sequence ACAAAGACCCCGAATTTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075685691_1075685692 -6 Left 1075685691 10:124363868-124363890 CCACGCAAATTCGGGGTCTTTGT No data
Right 1075685692 10:124363885-124363907 CTTTGTTGCAATGCAGAAGTCGG No data
1075685691_1075685696 26 Left 1075685691 10:124363868-124363890 CCACGCAAATTCGGGGTCTTTGT No data
Right 1075685696 10:124363917-124363939 TGCAACCAGGTAAGCACCAAAGG No data
1075685691_1075685694 13 Left 1075685691 10:124363868-124363890 CCACGCAAATTCGGGGTCTTTGT No data
Right 1075685694 10:124363904-124363926 TCGGGATCTTTCCTGCAACCAGG No data
1075685691_1075685697 27 Left 1075685691 10:124363868-124363890 CCACGCAAATTCGGGGTCTTTGT No data
Right 1075685697 10:124363918-124363940 GCAACCAGGTAAGCACCAAAGGG No data
1075685691_1075685693 -5 Left 1075685691 10:124363868-124363890 CCACGCAAATTCGGGGTCTTTGT No data
Right 1075685693 10:124363886-124363908 TTTGTTGCAATGCAGAAGTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075685691 Original CRISPR ACAAAGACCCCGAATTTGCG TGG (reversed) Intergenic
No off target data available for this crispr