ID: 1075685697

View in Genome Browser
Species Human (GRCh38)
Location 10:124363918-124363940
Sequence GCAACCAGGTAAGCACCAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075685690_1075685697 30 Left 1075685690 10:124363865-124363887 CCACCACGCAAATTCGGGGTCTT No data
Right 1075685697 10:124363918-124363940 GCAACCAGGTAAGCACCAAAGGG No data
1075685691_1075685697 27 Left 1075685691 10:124363868-124363890 CCACGCAAATTCGGGGTCTTTGT No data
Right 1075685697 10:124363918-124363940 GCAACCAGGTAAGCACCAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075685697 Original CRISPR GCAACCAGGTAAGCACCAAA GGG Intergenic
No off target data available for this crispr