ID: 1075685705

View in Genome Browser
Species Human (GRCh38)
Location 10:124363956-124363978
Sequence GCGGACGAGAGAATAATGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075685705_1075685709 1 Left 1075685705 10:124363956-124363978 CCTTCCATTATTCTCTCGTCCGC No data
Right 1075685709 10:124363980-124364002 AGCCCTAGCCCAGCACCTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075685705 Original CRISPR GCGGACGAGAGAATAATGGA AGG (reversed) Intergenic
No off target data available for this crispr