ID: 1075685877

View in Genome Browser
Species Human (GRCh38)
Location 10:124364787-124364809
Sequence GGGGAGGGAGGGCCTGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075685861_1075685877 29 Left 1075685861 10:124364735-124364757 CCATAGAAGAAGCAAGGGATGGT No data
Right 1075685877 10:124364787-124364809 GGGGAGGGAGGGCCTGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075685877 Original CRISPR GGGGAGGGAGGGCCTGAGAA AGG Intergenic
No off target data available for this crispr