ID: 1075687384

View in Genome Browser
Species Human (GRCh38)
Location 10:124373746-124373768
Sequence CTTCAAGCCCAGCTGGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075687384_1075687387 21 Left 1075687384 10:124373746-124373768 CCTGGGTCCAGCTGGGCTTGAAG No data
Right 1075687387 10:124373790-124373812 AGTTTTCTTTTCCCTTCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075687384 Original CRISPR CTTCAAGCCCAGCTGGACCC AGG (reversed) Intergenic
No off target data available for this crispr