ID: 1075692527

View in Genome Browser
Species Human (GRCh38)
Location 10:124407950-124407972
Sequence ATTCAAACCACAGTCTATGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075692525_1075692527 -9 Left 1075692525 10:124407936-124407958 CCTCCAATATCAAGATTCAAACC No data
Right 1075692527 10:124407950-124407972 ATTCAAACCACAGTCTATGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075692527 Original CRISPR ATTCAAACCACAGTCTATGT AGG Intronic
No off target data available for this crispr