ID: 1075697088

View in Genome Browser
Species Human (GRCh38)
Location 10:124444505-124444527
Sequence CAGGCACATGCTGCTATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075697088_1075697097 11 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697097 10:124444539-124444561 ACTCAGAAGGCTGAGGTGGGAGG 0: 641
1: 9859
2: 20969
3: 38223
4: 48485
1075697088_1075697098 26 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697098 10:124444554-124444576 GTGGGAGGCTCATTTGAGCCTGG No data
1075697088_1075697100 30 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697100 10:124444558-124444580 GAGGCTCATTTGAGCCTGGGAGG No data
1075697088_1075697093 4 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697093 10:124444532-124444554 CCCAGCTACTCAGAAGGCTGAGG 0: 3774
1: 101495
2: 206159
3: 237850
4: 152587
1075697088_1075697096 8 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697096 10:124444536-124444558 GCTACTCAGAAGGCTGAGGTGGG 0: 867
1: 17739
2: 114558
3: 209091
4: 219184
1075697088_1075697095 7 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697095 10:124444535-124444557 AGCTACTCAGAAGGCTGAGGTGG 0: 876
1: 14783
2: 29250
3: 41406
4: 36994
1075697088_1075697091 -2 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697091 10:124444526-124444548 TGTGGTCCCAGCTACTCAGAAGG 0: 318
1: 6825
2: 58377
3: 178568
4: 226411
1075697088_1075697099 27 Left 1075697088 10:124444505-124444527 CCAAACATAGCAGCATGTGCCTG No data
Right 1075697099 10:124444555-124444577 TGGGAGGCTCATTTGAGCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075697088 Original CRISPR CAGGCACATGCTGCTATGTT TGG (reversed) Intergenic
No off target data available for this crispr