ID: 1075698701

View in Genome Browser
Species Human (GRCh38)
Location 10:124454438-124454460
Sequence CAGTTTATGCAGAGGGAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075698696_1075698701 9 Left 1075698696 10:124454406-124454428 CCATGAATAGTGTTAACAATGGA No data
Right 1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG No data
1075698694_1075698701 19 Left 1075698694 10:124454396-124454418 CCGCTGAGTGCCATGAATAGTGT No data
Right 1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG No data
1075698693_1075698701 29 Left 1075698693 10:124454386-124454408 CCTTGAAGAGCCGCTGAGTGCCA No data
Right 1075698701 10:124454438-124454460 CAGTTTATGCAGAGGGAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075698701 Original CRISPR CAGTTTATGCAGAGGGAGTG GGG Intergenic
No off target data available for this crispr