ID: 1075702921

View in Genome Browser
Species Human (GRCh38)
Location 10:124480956-124480978
Sequence GGGGGTTATAAGGAGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075702918_1075702921 -7 Left 1075702918 10:124480940-124480962 CCTGTCTGTTTCTGTTGGGGGTT 0: 1
1: 0
2: 1
3: 16
4: 185
Right 1075702921 10:124480956-124480978 GGGGGTTATAAGGAGGCTGCAGG No data
1075702913_1075702921 2 Left 1075702913 10:124480931-124480953 CCACTGAAGCCTGTCTGTTTCTG 0: 1
1: 0
2: 1
3: 25
4: 300
Right 1075702921 10:124480956-124480978 GGGGGTTATAAGGAGGCTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075702921 Original CRISPR GGGGGTTATAAGGAGGCTGC AGG Intronic
No off target data available for this crispr