ID: 1075702973

View in Genome Browser
Species Human (GRCh38)
Location 10:124481285-124481307
Sequence TAGTGACAGCTACTACAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1598
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 1576}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075702973_1075702985 30 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702985 10:124481338-124481360 CACTGGTGGGGAATCGTGCCTGG No data
1075702973_1075702975 -3 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702975 10:124481305-124481327 CTACCACTCATGGCTGTATTTGG No data
1075702973_1075702977 -1 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702977 10:124481307-124481329 ACCACTCATGGCTGTATTTGGGG No data
1075702973_1075702981 17 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702981 10:124481325-124481347 TGGGGCCCTCTCTCACTGGTGGG No data
1075702973_1075702976 -2 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702976 10:124481306-124481328 TACCACTCATGGCTGTATTTGGG No data
1075702973_1075702980 16 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702980 10:124481324-124481346 TTGGGGCCCTCTCTCACTGGTGG No data
1075702973_1075702982 18 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702982 10:124481326-124481348 GGGGCCCTCTCTCACTGGTGGGG No data
1075702973_1075702979 13 Left 1075702973 10:124481285-124481307 CCTTTTTGTAGTAGCTGTCACTA 0: 1
1: 0
2: 1
3: 20
4: 1576
Right 1075702979 10:124481321-124481343 TATTTGGGGCCCTCTCTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075702973 Original CRISPR TAGTGACAGCTACTACAAAA AGG (reversed) Intronic
903432783 1:23320576-23320598 GAATGACAGCTTCAACAAAAGGG + Intronic
905083381 1:35346089-35346111 TTCTGACACATACTACAAAATGG - Intronic
906297892 1:44660173-44660195 CAGTGCCATCTACCACAAAAGGG - Exonic
907196667 1:52692751-52692773 CAGTGATAGCTGCTACAAACTGG - Exonic
907958890 1:59259892-59259914 TAGTGACAGCAATTTCAAGATGG - Intergenic
911125245 1:94335259-94335281 TAGTGGCAGCTCCTTCAAATCGG - Intergenic
913363043 1:118004008-118004030 TAGTGTCAGCATCAACAAAAAGG - Intronic
914215362 1:145622250-145622272 TATTGATAGATACTACAACATGG + Intronic
914467312 1:147942635-147942657 TATTGATAGATACTACAACATGG + Intronic
915293555 1:154903121-154903143 TACTGACATCTGCTACAATATGG + Intergenic
915533899 1:156522549-156522571 TAGTGACACATGCTACAACATGG - Intergenic
915719807 1:157976524-157976546 CAGTGATAACTACTACAAACAGG + Intergenic
916775386 1:167957410-167957432 TACTGACACATACTACAACATGG - Intronic
921593291 1:217028008-217028030 TCGTGACAGTTTCTAGAAAATGG - Intronic
921919790 1:220654993-220655015 TAGCAATAGCTCCTACAAAAGGG - Intronic
1063500055 10:6545423-6545445 TGGTGACACCTGCTACAACATGG + Intronic
1063792396 10:9467651-9467673 TAGTGATACATACTACAACATGG + Intergenic
1066630005 10:37449960-37449982 TTATGGCAGCTACTACATAATGG + Intergenic
1067919467 10:50438649-50438671 TATAGATAACTACTACAAAAGGG + Intronic
1068408673 10:56626284-56626306 TAGTGACTTCTGATACAAAAGGG + Intergenic
1068762173 10:60724335-60724357 TAGTCCCCTCTACTACAAAAAGG + Intronic
1068782140 10:60931489-60931511 TAGTGAAAGGTGCTACAATATGG - Intronic
1069401629 10:68053685-68053707 TAATGACAGCTAGAACAAAAAGG + Intronic
1070457547 10:76632396-76632418 CAGTGACACCTACTGCTAAAGGG - Intergenic
1070461093 10:76671376-76671398 TTGTGACAGATATTAAAAAATGG + Intergenic
1071813684 10:89209453-89209475 TCTTGACAGCCAATACAAAAAGG + Intergenic
1072234286 10:93439655-93439677 TAATGACAGCTCCTACTTAATGG + Intronic
1072938769 10:99739188-99739210 TAGTGAGAGCTTCTTCAAACTGG + Intronic
1074963187 10:118466134-118466156 TAGGGACCTCTAGTACAAAAAGG + Intergenic
1075635585 10:124028178-124028200 AAGTGACAGCAACAGCAAAAGGG + Intronic
1075702973 10:124481285-124481307 TAGTGACAGCTACTACAAAAAGG - Intronic
1076181293 10:128410886-128410908 TCATGAGAGCTACTACACAATGG + Intergenic
1078129309 11:8599960-8599982 TACTGACACATACTACAATATGG + Intergenic
1078810863 11:14761415-14761437 AATTGACTGTTACTACAAAATGG - Intronic
1080335427 11:31190025-31190047 TAGTGACGAGTAATACAAAATGG + Intronic
1082799629 11:57405118-57405140 TACTGACACCTGCTACAACACGG - Intronic
1083557615 11:63644340-63644362 TAATGCCAGCTTCTACAAAGGGG + Intronic
1085088193 11:73687061-73687083 TTCTGACACCTACTACAATATGG + Intronic
1085374144 11:76042833-76042855 TAGAGACATCTAGTAGAAAATGG - Intronic
1086595360 11:88564345-88564367 TAGTGCCAACCACTAGAAAACGG - Intronic
1087648899 11:100841281-100841303 TATTGACAGTTAATACCAAAGGG + Intronic
1088200965 11:107333841-107333863 CAGTGACACCTACTAGAATAGGG + Intronic
1089283047 11:117387719-117387741 TTGGGAAAGGTACTACAAAAAGG + Intronic
1095158200 12:38884352-38884374 TACTGACAGATACTACAACATGG - Intronic
1095335821 12:41024805-41024827 TAGTGACAAATACTTCCAAATGG + Intronic
1095434529 12:42172826-42172848 TACTGACAGATACTACAACATGG + Intronic
1095947520 12:47762019-47762041 TACTGACAGCTCCTATAAAGGGG + Intronic
1096329343 12:50696345-50696367 TACTGACAGATACTACAACATGG - Intronic
1097079560 12:56420205-56420227 TATTTACAAATACTACAAAAAGG + Intronic
1098359112 12:69637933-69637955 CACTAACTGCTACTACAAAAAGG + Intergenic
1099154034 12:79152100-79152122 CTGTGACAGATACTACTAAAGGG + Intronic
1103403407 12:120658667-120658689 TAGAGACAGCCACTCCAAACTGG - Intronic
1104883222 12:132086561-132086583 TTGTCATAACTACTACAAAATGG + Intronic
1105162103 13:17450337-17450359 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105168801 13:17556058-17556080 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105186085 13:17825257-17825279 TAGTTACAGTTTCTACCAAAAGG - Intergenic
1105197757 13:18006804-18006826 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1105197875 13:18008680-18008702 CAGTTACAGTTTCTACAAAAAGG - Intergenic
1106428818 13:29659548-29659570 TAGTAACAACAACAACAAAAAGG + Intergenic
1106888508 13:34216708-34216730 TAGTGACTTCTAATACAACATGG + Intergenic
1110295755 13:73863019-73863041 AAGTGACAGATAATCCAAAAAGG + Intronic
1110938581 13:81321425-81321447 TAGTCCCAACTACTACAAGAGGG - Intergenic
1112535504 13:100250547-100250569 AAGTTACAGCTATTACAAACAGG - Intronic
1115576972 14:34720953-34720975 TAGTGATACATACTACAAACTGG - Intergenic
1116513479 14:45776837-45776859 TTGTGACATCTACAACTAAAAGG - Intergenic
1117155334 14:52933830-52933852 TGGTAAGAGCTACTAGAAAAAGG - Intronic
1118643675 14:67817239-67817261 TAGTCCCAGCTACTACAGGAAGG - Intergenic
1121474139 14:94179377-94179399 TACTGATAGCTGCTACAACATGG - Intronic
1126560662 15:50040283-50040305 TAGCCACAGCTGCTACAAACAGG + Intronic
1128741519 15:70087183-70087205 TAGTGAAAACAAATACAAAATGG + Intronic
1131672874 15:94639116-94639138 TACTGATAAATACTACAAAATGG + Intergenic
1133367586 16:5223025-5223047 TATGCACAGCTACTAAAAAATGG - Intergenic
1135181492 16:20278389-20278411 TAGTTTCCCCTACTACAAAATGG - Intergenic
1138250870 16:55500899-55500921 TAGTGAAAGCTTCTACAAGCAGG - Intronic
1138798548 16:59998687-59998709 TAGGGACAGCTGATAGAAAAGGG + Intergenic
1141107173 16:81243099-81243121 GAGTGACAGCTAATGCATAAGGG + Intronic
1143329750 17:6124836-6124858 AAGTTACAGTAACTACAAAAGGG - Intergenic
1144839349 17:18176040-18176062 TAGGGAAAGCTTCTAGAAAAAGG - Intronic
1145117042 17:20220420-20220442 TACTCACAGCTACTATAAATGGG + Intronic
1146066324 17:29638666-29638688 TAGTCCCAGCTACTACTAAAAGG - Intronic
1147334838 17:39721064-39721086 TAGTCCCAGCTACTGCAGAAGGG - Intronic
1148618658 17:49018180-49018202 TCTTGACAGCTACTACACACTGG - Intronic
1150182108 17:63133706-63133728 TATTGACAGCTAATGCAAAATGG + Intronic
1152381402 17:79944220-79944242 TAGAGCCAGCTCCTGCAAAAGGG + Intronic
1154559737 18:15810671-15810693 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154560040 18:15815079-15815101 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154560262 18:15818133-15818155 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154560643 18:15823211-15823233 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154561963 18:15841373-15841395 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154561989 18:15841710-15841732 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154562523 18:15849175-15849197 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154562671 18:15851210-15851232 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154562819 18:15853245-15853267 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154563223 18:15858674-15858696 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154563446 18:15861733-15861755 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154564032 18:15869887-15869909 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154564288 18:15873281-15873303 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154565017 18:15883457-15883479 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154565514 18:15890572-15890594 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154565667 18:15892606-15892628 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154566054 18:15898035-15898057 CAGTTCCAGATACTACAAAACGG - Intergenic
1154566207 18:15900069-15900091 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154566257 18:15900744-15900766 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154566408 18:15902779-15902801 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154566557 18:15904814-15904836 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154566858 18:15908884-15908906 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154567306 18:15914853-15914875 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154567758 18:15921128-15921150 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154568016 18:15924522-15924544 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154568976 18:15937764-15937786 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154569127 18:15939799-15939821 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154569577 18:15945905-15945927 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154569727 18:15947941-15947963 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154569878 18:15949976-15949998 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154570030 18:15952011-15952033 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154570432 18:15957446-15957468 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154570582 18:15959481-15959503 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154570764 18:15961853-15961875 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154570916 18:15963889-15963911 CAGTTCCAGATACTACAAAACGG - Intergenic
1154571275 18:15968635-15968657 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154571414 18:15970666-15970688 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154571708 18:15974737-15974759 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154572848 18:15990354-15990376 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154572999 18:15992390-15992412 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154573779 18:16003251-16003273 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154574149 18:16008337-16008359 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154574200 18:16009012-16009034 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154574705 18:16015807-16015829 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154574755 18:16016482-16016504 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154575036 18:16020219-16020241 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154575283 18:16023614-16023636 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154575430 18:16025648-16025670 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154576017 18:16033788-16033810 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154576614 18:16041942-16041964 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154576762 18:16043976-16043998 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154576912 18:16046011-16046033 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154577530 18:16054505-16054527 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154577680 18:16056540-16056562 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154577830 18:16058574-16058596 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154577980 18:16060610-16060632 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154578101 18:16062305-16062327 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154578249 18:16064340-16064362 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154578399 18:16066375-16066397 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154579024 18:16074865-16074887 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154579265 18:16078253-16078275 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154579487 18:16081307-16081329 CAGTTCCAGATACTACAAAACGG - Intergenic
1154579937 18:16087426-16087448 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154580228 18:16091496-16091518 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154580376 18:16093531-16093553 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154580596 18:16096587-16096609 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154580747 18:16098623-16098645 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154580966 18:16101676-16101698 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154581119 18:16103714-16103736 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154581271 18:16105749-16105771 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154581765 18:16112539-16112561 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154582029 18:16116105-16116127 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154582348 18:16120518-16120540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154582535 18:16123057-16123079 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154583033 18:16130019-16130041 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154583183 18:16132055-16132077 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154583603 18:16137829-16137851 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154583872 18:16141558-16141580 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154584194 18:16145966-16145988 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154584487 18:16150036-16150058 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154584779 18:16154102-16154124 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154585499 18:16163940-16163962 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154585866 18:16169029-16169051 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154586014 18:16171064-16171086 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154586263 18:16174460-16174482 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154586463 18:16177171-16177193 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154586609 18:16179206-16179228 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154586761 18:16181241-16181263 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154586982 18:16184294-16184316 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154587285 18:16188364-16188386 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154587526 18:16191578-16191600 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154588545 18:16205516-16205538 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154588687 18:16207385-16207407 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154588715 18:16207722-16207744 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154588865 18:16209759-16209781 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154589060 18:16212469-16212491 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154589564 18:16219261-16219283 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154589713 18:16221296-16221318 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154590159 18:16227554-16227576 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154590313 18:16229590-16229612 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154590461 18:16231626-16231648 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154590614 18:16233662-16233684 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154590736 18:16235355-16235377 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154590887 18:16237391-16237413 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154591131 18:16240786-16240808 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154591282 18:16242821-16242843 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154591583 18:16246748-16246770 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154591933 18:16251505-16251527 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154592575 18:16260331-16260353 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154592923 18:16265086-16265108 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154593075 18:16267121-16267143 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154593225 18:16269157-16269179 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154593446 18:16272211-16272233 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154593498 18:16272886-16272908 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154593697 18:16275596-16275618 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154594141 18:16281702-16281724 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154594589 18:16287808-16287830 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154594791 18:16290518-16290540 CAGTTCCAGATACTACAAAACGG - Intergenic
1154595637 18:16302233-16302255 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154595787 18:16304268-16304290 CAGTTCCAGATACTACAAAACGG - Intergenic
1154595936 18:16306303-16306325 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154596087 18:16308338-16308360 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154596386 18:16312409-16312431 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154596826 18:16318514-16318536 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154596976 18:16320548-16320570 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154597492 18:16327672-16327694 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154597518 18:16328009-16328031 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154597569 18:16328686-16328708 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154598602 18:16342941-16342963 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154598751 18:16344976-16344998 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154599051 18:16349048-16349070 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154599248 18:16351757-16351779 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154599401 18:16353793-16353815 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154599798 18:16359224-16359246 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154600021 18:16362280-16362302 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154600296 18:16366012-16366034 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154600323 18:16366349-16366371 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154600624 18:16370420-16370442 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154600849 18:16373472-16373494 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154600999 18:16375507-16375529 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154601150 18:16377543-16377565 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154601300 18:16379578-16379600 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154601840 18:16387049-16387071 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154601988 18:16389084-16389106 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154602136 18:16391119-16391141 CAGTTCCAGATACTACAAAACGG - Intergenic
1154602282 18:16393155-16393177 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154602678 18:16398586-16398608 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154602830 18:16400622-16400644 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154602980 18:16402657-16402679 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154603302 18:16407070-16407092 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154603435 18:16408933-16408955 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154603585 18:16410970-16410992 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154603882 18:16415041-16415063 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154604032 18:16417076-16417098 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154604477 18:16423182-16423204 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154604773 18:16427252-16427274 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154604925 18:16429287-16429309 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154605152 18:16432372-16432394 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154605295 18:16434415-16434437 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154606080 18:16445287-16445309 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154606232 18:16447324-16447346 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154606537 18:16451402-16451424 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154607121 18:16459222-16459244 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154607268 18:16461257-16461279 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154607812 18:16468724-16468746 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154608153 18:16473478-16473500 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154608593 18:16479588-16479610 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154608886 18:16483658-16483680 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154609558 18:16493148-16493170 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154609866 18:16497384-16497406 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154610237 18:16502475-16502497 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154610539 18:16506547-16506569 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154610840 18:16510620-16510642 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154611154 18:16515024-16515046 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154611304 18:16517059-16517081 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154611721 18:16522828-16522850 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154612069 18:16527583-16527605 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154612220 18:16529618-16529640 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154614136 18:16556083-16556105 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154614188 18:16556758-16556780 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154614337 18:16558793-16558815 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154615178 18:16570331-16570353 CAGTTCCAGATACTACAAAACGG - Intergenic
1154615328 18:16572372-16572394 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154615476 18:16574407-16574429 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154615626 18:16576442-16576464 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154615827 18:16579152-16579174 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154616122 18:16583225-16583247 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154617219 18:16598502-16598524 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154617269 18:16599177-16599199 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154617421 18:16601213-16601235 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154617870 18:16607318-16607340 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154618187 18:16611725-16611747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154618332 18:16613758-16613780 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154618851 18:16620895-16620917 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154619001 18:16622930-16622952 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154619221 18:16625983-16626005 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154619372 18:16628020-16628042 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154619523 18:16630055-16630077 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154619672 18:16632092-16632114 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154620069 18:16637523-16637545 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154621039 18:16650772-16650794 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154621556 18:16658064-16658086 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154621707 18:16660100-16660122 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154621856 18:16662134-16662156 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154622159 18:16666205-16666227 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154622309 18:16668240-16668262 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154622457 18:16670276-16670298 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154622578 18:16671969-16671991 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154622972 18:16677400-16677422 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154623022 18:16678075-16678097 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154623423 18:16683506-16683528 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154623473 18:16684181-16684203 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154624191 18:16694033-16694055 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154625075 18:16706240-16706262 CAGTTCCAGATACTACAAAACGG - Intergenic
1154625100 18:16706578-16706600 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154625600 18:16713357-16713379 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154625897 18:16717427-16717449 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154626223 18:16721840-16721862 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154626373 18:16723878-16723900 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154626704 18:16728453-16728475 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154627457 18:16738804-16738826 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154627601 18:16740841-16740863 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154627748 18:16742878-16742900 CAGTTCCAGATACTACAAAACGG - Intergenic
1154628040 18:16746950-16746972 CAGTTCCAGATACTACAAAACGG - Intergenic
1154628507 18:16753387-16753409 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154628660 18:16755422-16755444 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154628877 18:16758477-16758499 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154629510 18:16767130-16767152 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154629769 18:16770805-16770827 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154629850 18:16772012-16772034 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154629999 18:16774047-16774069 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154630259 18:16777616-16777638 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154630406 18:16779651-16779673 CAGTTCCAGATACTACAAAACGG - Intergenic
1154630553 18:16781688-16781710 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154630706 18:16783724-16783746 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154630854 18:16785759-16785781 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154631203 18:16790514-16790536 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154631422 18:16793572-16793594 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154631836 18:16799342-16799364 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154631986 18:16801378-16801400 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154632137 18:16803413-16803435 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154632287 18:16805449-16805471 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154632338 18:16806124-16806146 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154632657 18:16810539-16810561 CAGTTGCAGATACTACAAAAGGG - Intergenic
1154633494 18:16822076-16822098 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154633870 18:16827159-16827181 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154633899 18:16827496-16827518 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154634450 18:16834960-16834982 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154634601 18:16836995-16837017 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154634751 18:16839030-16839052 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154635104 18:16843779-16843801 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154635253 18:16845814-16845836 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154635891 18:16854640-16854662 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154636753 18:16866539-16866561 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154636951 18:16869249-16869271 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154637298 18:16874006-16874028 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154637972 18:16883105-16883127 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154638149 18:16885482-16885504 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154638295 18:16887517-16887539 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154638809 18:16894652-16894674 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154638960 18:16896689-16896711 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154639110 18:16898724-16898746 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154639902 18:16909588-16909610 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154640250 18:16914343-16914365 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154640399 18:16916378-16916400 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154641751 18:16935034-16935056 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154641900 18:16937069-16937091 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154642050 18:16939106-16939128 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154642101 18:16939781-16939803 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154642346 18:16943177-16943199 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154642642 18:16947247-16947269 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154642956 18:16951655-16951677 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154643108 18:16953691-16953713 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154643399 18:16957761-16957783 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154643744 18:16962518-16962540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154643893 18:16964553-16964575 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154644123 18:16967777-16967799 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154644293 18:16970148-16970170 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154645248 18:16983384-16983406 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154645396 18:16985419-16985441 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154645841 18:16991525-16991547 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154646236 18:16996954-16996976 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154646777 18:17004426-17004448 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154647027 18:17007821-17007843 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154647673 18:17016644-17016666 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154648219 18:17024109-17024131 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154648414 18:17026819-17026841 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154649113 18:17036326-17036348 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154649255 18:17038361-17038383 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154649553 18:17042431-17042453 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154649804 18:17045826-17045848 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154650233 18:17051599-17051621 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154650638 18:17057193-17057215 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154650785 18:17059228-17059250 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154650939 18:17061264-17061286 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154651306 18:17066364-17066386 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154651746 18:17072464-17072486 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154651892 18:17074499-17074521 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154652044 18:17076534-17076556 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154652717 18:17085694-17085716 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154652869 18:17087729-17087751 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154653183 18:17092139-17092161 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154653601 18:17097916-17097938 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154654197 18:17106232-17106254 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154654444 18:17109625-17109647 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154655532 18:17124720-17124742 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154655583 18:17125395-17125417 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154655734 18:17127430-17127452 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154655885 18:17129466-17129488 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154656330 18:17135568-17135590 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154656480 18:17137603-17137625 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154657131 18:17146426-17146448 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154657330 18:17149136-17149158 CAGTTCCAGATACTACAAAACGG - Intergenic
1154657481 18:17151171-17151193 CAGTTCCAGATACTACAAAACGG - Intergenic
1154657506 18:17151509-17151531 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154658060 18:17159140-17159162 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154658358 18:17163210-17163232 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154659147 18:17174074-17174096 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154659198 18:17174749-17174771 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154659471 18:17178482-17178504 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154659751 18:17182381-17182403 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154659897 18:17184416-17184438 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660095 18:17187126-17187148 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660348 18:17190513-17190535 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660496 18:17192548-17192570 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660547 18:17193223-17193245 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660695 18:17195260-17195282 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660844 18:17197295-17197317 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154660995 18:17199331-17199353 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154661147 18:17201365-17201387 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154661294 18:17203400-17203422 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154661444 18:17205435-17205457 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154661741 18:17209507-17209529 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154661891 18:17211542-17211564 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154661946 18:17212217-17212239 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154662095 18:17214256-17214278 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154662243 18:17216292-17216314 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154662388 18:17218327-17218349 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154662440 18:17219002-17219024 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154662490 18:17219677-17219699 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154662737 18:17223077-17223099 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154663279 18:17230534-17230556 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154663429 18:17232570-17232592 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154663553 18:17234264-17234286 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154664144 18:17242418-17242440 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154664590 18:17248523-17248545 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154664740 18:17250559-17250581 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154665139 18:17255989-17256011 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154665288 18:17258025-17258047 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154665729 18:17264129-17264151 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154665876 18:17266163-17266185 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154666179 18:17270234-17270256 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154666820 18:17279058-17279080 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154666920 18:17280405-17280427 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154667068 18:17282439-17282461 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154667117 18:17283113-17283135 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154667272 18:17285148-17285170 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154667424 18:17287182-17287204 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154667722 18:17291252-17291274 CAGTTCCAGATACTACAAAATGG - Intergenic
1154667769 18:17291928-17291950 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154668017 18:17295322-17295344 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154668171 18:17297358-17297380 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154668647 18:17303801-17303823 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154668798 18:17305836-17305858 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154669001 18:17308719-17308741 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154669155 18:17310754-17310776 CAGTTCCAGATACTACAAAACGG - Intergenic
1154669301 18:17312790-17312812 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154669793 18:17319572-17319594 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154670196 18:17325003-17325025 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154670345 18:17327038-17327060 CAGTTCCAGATACTACAAAACGG - Intergenic
1154670494 18:17329073-17329095 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154670647 18:17331112-17331134 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154671050 18:17336541-17336563 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154671202 18:17338576-17338598 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154671353 18:17340615-17340637 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154671503 18:17342650-17342672 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154671652 18:17344686-17344708 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154671799 18:17346721-17346743 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154672249 18:17352829-17352851 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154672549 18:17357068-17357090 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154673295 18:17367256-17367278 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154673544 18:17370652-17370674 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154673696 18:17372688-17372710 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154673947 18:17376085-17376107 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154674323 18:17381183-17381205 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154674663 18:17385931-17385953 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154675010 18:17390677-17390699 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154675160 18:17392714-17392736 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154675308 18:17394749-17394771 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154675579 18:17398481-17398503 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154675874 18:17402551-17402573 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676073 18:17405267-17405289 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676127 18:17405942-17405964 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676180 18:17406617-17406639 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676330 18:17408653-17408675 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676480 18:17410688-17410710 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676625 18:17412724-17412746 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154676752 18:17414421-17414443 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154677114 18:17419338-17419360 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154677265 18:17421374-17421396 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154677465 18:17424086-17424108 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154677853 18:17429517-17429539 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154678005 18:17431552-17431574 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154678155 18:17433587-17433609 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154678645 18:17440379-17440401 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154679257 18:17448863-17448885 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154679403 18:17450897-17450919 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154679950 18:17458363-17458385 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154680197 18:17461758-17461780 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154680345 18:17463793-17463815 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154680790 18:17469898-17469920 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154680944 18:17471936-17471958 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154681091 18:17473971-17473993 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154681448 18:17478725-17478747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154681770 18:17483138-17483160 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154682069 18:17487207-17487229 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154682220 18:17489242-17489264 CAGTTCCAGATACTACAAAACGG - Intergenic
1154682574 18:17494166-17494188 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154682726 18:17496201-17496223 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154682996 18:17499929-17499951 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683147 18:17501964-17501986 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683201 18:17502640-17502662 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683351 18:17504675-17504697 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683501 18:17506710-17506732 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683699 18:17509420-17509442 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683752 18:17510096-17510118 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683775 18:17510433-17510455 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154683803 18:17510770-17510792 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154684101 18:17514840-17514862 CAGTTCCAGATACTACAAAACGG - Intergenic
1154684461 18:17519928-17519950 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154684525 18:17520770-17520792 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154684673 18:17522805-17522827 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154685596 18:17535529-17535551 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154686033 18:17541632-17541654 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154686421 18:17547052-17547074 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154686866 18:17553168-17553190 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687060 18:17555878-17555900 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687206 18:17557913-17557935 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687353 18:17559948-17559970 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687501 18:17561983-17562005 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687653 18:17564022-17564044 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687902 18:17567417-17567439 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154687953 18:17568092-17568114 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154688103 18:17570127-17570149 CAGTTCCAGATACTACAAAACGG - Intergenic
1154688349 18:17573522-17573544 CAGTTCCAGATACTACAAAACGG - Intergenic
1154688934 18:17581507-17581529 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154689078 18:17583545-17583567 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154689609 18:17590675-17590697 CAGTTCCAGATACTACAAAACGG - Intergenic
1154690201 18:17598824-17598846 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154690255 18:17599499-17599521 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154690404 18:17601534-17601556 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154690753 18:17606279-17606301 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154691194 18:17612385-17612407 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154691245 18:17613060-17613082 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154691441 18:17615772-17615794 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154691895 18:17621878-17621900 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154692387 18:17628658-17628680 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154692537 18:17630694-17630716 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154692687 18:17632731-17632753 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154692985 18:17636802-17636824 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154693627 18:17645625-17645647 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154693814 18:17648336-17648358 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154693868 18:17649011-17649033 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154694016 18:17651047-17651069 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154694139 18:17652744-17652766 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154694719 18:17660883-17660905 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154694871 18:17662917-17662939 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154695019 18:17664953-17664975 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154695171 18:17666988-17667010 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154695469 18:17671059-17671081 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154695616 18:17673095-17673117 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154696117 18:17679889-17679911 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154696763 18:17688716-17688738 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154696998 18:17691940-17691962 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154697664 18:17701091-17701113 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154697860 18:17703802-17703824 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154698159 18:17707872-17707894 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154698604 18:17713981-17714003 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154699136 18:17721112-17721134 CAGTTGCAGATACTACAAAAGGG - Intergenic
1154699433 18:17725182-17725204 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154699978 18:17732809-17732831 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154700421 18:17738926-17738948 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154700619 18:17741639-17741661 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154701041 18:17747401-17747423 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154701756 18:17757247-17757269 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154701954 18:17759958-17759980 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154702104 18:17761993-17762015 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154702646 18:17769459-17769481 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154702793 18:17771495-17771517 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154703973 18:17787790-17787812 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154704122 18:17789826-17789848 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154704376 18:17793221-17793243 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154704629 18:17796616-17796638 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154704775 18:17798652-17798674 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154705041 18:17802381-17802403 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154705409 18:17807124-17807146 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154705555 18:17809160-17809182 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154705812 18:17812554-17812576 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154706399 18:17820698-17820720 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154706546 18:17822733-17822755 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154706945 18:17828163-17828185 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154707241 18:17832233-17832255 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154707963 18:17842254-17842276 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154708084 18:17843952-17843974 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154708136 18:17844627-17844649 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154708283 18:17846662-17846684 CAGTTCCAGATACTACAAAACGG - Intergenic
1154708432 18:17848697-17848719 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154708670 18:17852092-17852114 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154709284 18:17860580-17860602 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154709628 18:17865330-17865352 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154709779 18:17867365-17867387 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154709974 18:17870076-17870098 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154710220 18:17873471-17873493 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154710475 18:17876856-17876878 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154710791 18:17881260-17881282 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154710924 18:17883124-17883146 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154711211 18:17887194-17887216 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154711464 18:17890589-17890611 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154711661 18:17893299-17893321 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154711811 18:17895334-17895356 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154712081 18:17899063-17899085 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154712374 18:17903135-17903157 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154712673 18:17907205-17907227 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154712999 18:17911781-17911803 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154713126 18:17913479-17913501 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154713274 18:17915514-17915536 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154714114 18:17927048-17927070 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154714462 18:17931793-17931815 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154714612 18:17933828-17933850 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154714762 18:17935863-17935885 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154715132 18:17940954-17940976 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154715281 18:17942989-17943011 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154715779 18:17949782-17949804 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154715932 18:17951817-17951839 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154715982 18:17952492-17952514 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154716409 18:17958265-17958287 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154716525 18:17959958-17959980 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154716576 18:17960633-17960655 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154716727 18:17962667-17962689 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154716877 18:17964703-17964725 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154717078 18:17967414-17967436 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154717326 18:17970808-17970830 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154717521 18:17973518-17973540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154717697 18:17975890-17975912 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154717995 18:17979959-17979981 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154718261 18:17983512-17983534 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154718557 18:17987585-17987607 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154719010 18:17993698-17993720 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154719477 18:18000150-18000172 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154719742 18:18003875-18003897 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154719915 18:18006250-18006272 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720066 18:18008285-18008307 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720216 18:18010320-18010342 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720393 18:18012697-18012719 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720444 18:18013372-18013394 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720627 18:18015912-18015934 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720782 18:18017947-18017969 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154720811 18:18018284-18018306 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154721244 18:18024215-18024237 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154721698 18:18030489-18030511 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154722047 18:18035243-18035265 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154722391 18:18039987-18040009 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154723106 18:18049984-18050006 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154723452 18:18054730-18054752 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154723571 18:18056424-18056446 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154723819 18:18059820-18059842 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154724111 18:18063890-18063912 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154724367 18:18067285-18067307 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154724517 18:18069320-18069342 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154724702 18:18071860-18071882 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154724997 18:18075931-18075953 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154725049 18:18076606-18076628 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154725200 18:18078641-18078663 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154725442 18:18082036-18082058 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154725963 18:18089163-18089185 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154726108 18:18091199-18091221 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154726258 18:18093234-18093256 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154726533 18:18096970-18096992 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154726733 18:18099679-18099701 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154727039 18:18103921-18103943 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154727342 18:18107993-18108015 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154727539 18:18110702-18110724 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154727689 18:18112737-18112759 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154728013 18:18117144-18117166 CAGTTCCAGATACTACAAAACGG - Intergenic
1154728703 18:18126646-18126668 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154728854 18:18128680-18128702 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154729004 18:18130715-18130737 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154729408 18:18136141-18136163 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154730143 18:18146316-18146338 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154730753 18:18154806-18154828 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154730956 18:18157677-18157699 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154731208 18:18161072-18161094 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154731359 18:18163107-18163129 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154731878 18:18170233-18170255 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154732330 18:18176512-18176534 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154732678 18:18181261-18181283 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154733133 18:18187369-18187391 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154733400 18:18191097-18191119 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154733546 18:18193131-18193153 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154733918 18:18198221-18198243 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154734316 18:18203652-18203674 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154734469 18:18205687-18205709 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154734615 18:18207722-18207744 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154734910 18:18211792-18211814 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154735045 18:18213656-18213678 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154735195 18:18215693-18215715 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154735343 18:18217727-18217749 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154735749 18:18223330-18223352 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154735978 18:18226544-18226566 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154736613 18:18235191-18235213 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154736664 18:18235866-18235888 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154736810 18:18237901-18237923 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154737062 18:18241296-18241318 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154737403 18:18246045-18246067 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154737584 18:18248425-18248447 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154737785 18:18251135-18251157 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154738128 18:18255882-18255904 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154738568 18:18261988-18262010 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154738842 18:18265718-18265740 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154738892 18:18266393-18266415 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154739291 18:18271825-18271847 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154739543 18:18275220-18275242 CAGTTCCAGATACTACAAAACGG - Intergenic
1154740031 18:18282006-18282028 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154740187 18:18284041-18284063 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154740312 18:18285737-18285759 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154740930 18:18294210-18294232 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154741329 18:18299642-18299664 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154741779 18:18305749-18305771 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154742130 18:18310507-18310529 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154742282 18:18312541-18312563 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154742580 18:18316612-18316634 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154742868 18:18320516-18320538 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154742920 18:18321191-18321213 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154743356 18:18327133-18327155 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154743756 18:18332733-18332755 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154744022 18:18336460-18336482 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154744169 18:18338496-18338518 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154744472 18:18342566-18342588 CAGTTCCAGATACTACAAAACGG - Intergenic
1154744920 18:18348845-18348867 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154745092 18:18351220-18351242 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154745243 18:18353255-18353277 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154745586 18:18358010-18358032 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154745936 18:18362767-18362789 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746234 18:18366837-18366859 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746285 18:18367512-18367534 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746582 18:18371583-18371605 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746733 18:18373618-18373640 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746884 18:18375654-18375676 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746935 18:18376329-18376351 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154746988 18:18377004-18377026 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154747062 18:18378017-18378039 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154747212 18:18380051-18380073 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154747473 18:18383782-18383804 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154747623 18:18385817-18385839 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154747819 18:18388526-18388548 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154748068 18:18391921-18391943 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154748450 18:18397180-18397202 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154748600 18:18399216-18399238 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154748794 18:18401925-18401947 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154748942 18:18403960-18403982 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154748993 18:18404635-18404657 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154749681 18:18414134-18414156 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154750449 18:18424632-18424654 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154750747 18:18428703-18428725 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154751091 18:18433452-18433474 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154751386 18:18437523-18437545 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154751438 18:18438198-18438220 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154752059 18:18446848-18446870 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154752352 18:18450917-18450939 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154752968 18:18459406-18459428 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154753163 18:18462111-18462133 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154753706 18:18469576-18469598 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154754098 18:18475005-18475027 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154754307 18:18477885-18477907 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154754627 18:18482293-18482315 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154754800 18:18484670-18484692 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154754944 18:18486704-18486726 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154755164 18:18489758-18489780 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154755388 18:18492805-18492827 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154755509 18:18494498-18494520 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154755963 18:18500604-18500626 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154756229 18:18504334-18504356 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154756557 18:18508669-18508691 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154756798 18:18512063-18512085 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154756921 18:18513756-18513778 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154757074 18:18515791-18515813 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154757223 18:18517826-18517848 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154757528 18:18522065-18522087 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154757679 18:18524100-18524122 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154757839 18:18526307-18526329 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154758188 18:18530878-18530900 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154758640 18:18536982-18537004 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154759081 18:18543087-18543109 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154759526 18:18549194-18549216 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154759678 18:18551229-18551251 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154759731 18:18551904-18551926 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154760039 18:18555974-18555996 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154760258 18:18559032-18559054 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154760411 18:18561067-18561089 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154760558 18:18563102-18563124 CAGTTCCAGATACTACAAAACGG - Intergenic
1154760997 18:18569205-18569227 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154761146 18:18571241-18571263 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154761298 18:18573276-18573298 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154761768 18:18579723-18579745 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154761917 18:18581758-18581780 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154762113 18:18584463-18584485 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154762425 18:18588703-18588725 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154762730 18:18592775-18592797 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154762882 18:18594810-18594832 CAGTTCCAGATACTACAAAACGG - Intergenic
1154763177 18:18598880-18598902 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154763476 18:18603117-18603139 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154763658 18:18605660-18605682 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154764148 18:18612445-18612467 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154764269 18:18614138-18614160 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154764882 18:18622621-18622643 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154765178 18:18626691-18626713 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154765479 18:18630763-18630785 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154765601 18:18632456-18632478 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154766071 18:18638899-18638921 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154766850 18:18649750-18649772 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767197 18:18654510-18654532 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767249 18:18655185-18655207 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767368 18:18656882-18656904 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767398 18:18657218-18657240 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767548 18:18659254-18659276 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767696 18:18661293-18661315 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154767942 18:18664688-18664710 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154768516 18:18672485-18672507 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154768941 18:18678258-18678280 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154769093 18:18680292-18680314 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154769263 18:18682666-18682688 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154769384 18:18684359-18684381 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154769674 18:18688269-18688291 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154769966 18:18692339-18692361 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154770117 18:18694374-18694396 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154770256 18:18696237-18696259 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154770549 18:18700307-18700329 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154770699 18:18702343-18702365 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154770837 18:18704207-18704229 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154771224 18:18709628-18709650 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154771519 18:18713697-18713719 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154771764 18:18717093-18717115 CAGTTCCAGATACTACAAAACGG - Intergenic
1154771913 18:18719128-18719150 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154772164 18:18722525-18722547 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154772312 18:18724561-18724583 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154772363 18:18725236-18725258 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154772810 18:18731508-18731530 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154772864 18:18732183-18732205 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154773111 18:18735580-18735602 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154773262 18:18737615-18737637 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154773297 18:18738120-18738142 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154773542 18:18741518-18741540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154773885 18:18746266-18746288 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154774033 18:18748302-18748324 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154774185 18:18750337-18750359 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154774461 18:18754074-18754096 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154774685 18:18757145-18757167 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154774996 18:18761385-18761407 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154775047 18:18762060-18762082 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154775563 18:18769183-18769205 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154775871 18:18773425-18773447 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154776323 18:18779530-18779552 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154776615 18:18783599-18783621 CAGTTCCAGATACTACAAAACGG - Intergenic
1154776761 18:18785634-18785656 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154777131 18:18790725-18790747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154777182 18:18791400-18791422 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154777435 18:18794794-18794816 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154777800 18:18799880-18799902 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154777977 18:18802259-18802281 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154778373 18:18807683-18807705 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154778419 18:18808358-18808380 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154778469 18:18809035-18809057 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154778886 18:18814802-18814824 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154779802 18:18827201-18827223 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154780680 18:18839579-18839601 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154780950 18:18843309-18843331 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154781351 18:18848907-18848929 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154781403 18:18849582-18849604 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154781929 18:18856876-18856898 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154782051 18:18858569-18858591 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154782206 18:18860605-18860627 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154782506 18:18864675-18864697 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154782656 18:18866709-18866731 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154782806 18:18868744-18868766 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154783205 18:18874173-18874195 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154783622 18:18879944-18879966 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154784435 18:18891143-18891165 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154784485 18:18891818-18891840 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154784515 18:18892155-18892177 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154784961 18:18898261-18898283 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154785107 18:18900296-18900318 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154785256 18:18902333-18902355 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154785401 18:18904371-18904393 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154785452 18:18905047-18905069 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154785848 18:18910477-18910499 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154785999 18:18912512-18912534 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154786146 18:18914547-18914569 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154786199 18:18915222-18915244 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154786318 18:18916916-18916938 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154786708 18:18922346-18922368 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154787057 18:18927090-18927112 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154787761 18:18936928-18936950 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154788176 18:18942690-18942712 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154788326 18:18944725-18944747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154788474 18:18946760-18946782 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154788901 18:18952687-18952709 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154789099 18:18955397-18955419 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154789242 18:18957425-18957447 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154789390 18:18959460-18959482 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154789539 18:18961495-18961517 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154789879 18:18966242-18966264 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154790027 18:18968278-18968300 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154790078 18:18968953-18968975 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154790129 18:18969628-18969650 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154790602 18:18976073-18976095 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154790724 18:18977771-18977793 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154790898 18:18980142-18980164 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154791021 18:18981833-18981855 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154791143 18:18983526-18983548 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154791297 18:18985564-18985586 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154791819 18:18992691-18992713 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154792021 18:18995411-18995433 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154792320 18:18999481-18999503 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154792544 18:19002529-19002551 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154793036 18:19009320-19009342 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154793087 18:19009995-19010017 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154793233 18:19012032-19012054 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154793909 18:19021533-19021555 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154794063 18:19023569-19023591 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154794311 18:19026963-19026985 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154794461 18:19028999-19029021 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154794657 18:19031708-19031730 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154794779 18:19033401-19033423 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154794930 18:19035438-19035460 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154795183 18:19038835-19038857 CAGTTCCAGATACTACAAAACGG - Intergenic
1154795479 18:19042905-19042927 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154795630 18:19044940-19044962 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154795777 18:19046975-19046997 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154795924 18:19049012-19049034 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154795974 18:19049687-19049709 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154796221 18:19053082-19053104 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154796754 18:19060546-19060568 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154797000 18:19063941-19063963 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154797151 18:19065976-19065998 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154797797 18:19074799-19074821 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154797930 18:19076663-19076685 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798156 18:19079716-19079738 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798299 18:19081755-19081777 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798526 18:19084807-19084829 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798579 18:19085482-19085504 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798727 18:19087518-19087540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798778 18:19088193-19088215 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154798902 18:19089886-19089908 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154799192 18:19093955-19093977 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154799291 18:19095314-19095336 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154799483 18:19098025-19098047 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154799628 18:19100060-19100082 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154799775 18:19102095-19102117 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154800072 18:19106164-19106186 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154800220 18:19108198-19108220 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154800446 18:19111250-19111272 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154800793 18:19115996-19116018 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154801044 18:19119395-19119417 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154801951 18:19131948-19131970 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154802104 18:19133984-19134006 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154802397 18:19138053-19138075 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154802547 18:19140090-19140112 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154803068 18:19147380-19147402 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154803263 18:19150091-19150113 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154803312 18:19150766-19150788 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154803363 18:19151442-19151464 CAGTTCCAGATACTACAAAACGG - Intergenic
1154803552 18:19154153-19154175 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154803709 18:19156189-19156211 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154803955 18:19159584-19159606 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154804103 18:19161620-19161642 CAGTTCCAGATACTACAAAACGG - Intergenic
1154804405 18:19165689-19165711 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154804552 18:19167725-19167747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154805160 18:19176037-19176059 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154805309 18:19178071-19178093 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154805935 18:19186675-19186697 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154806083 18:19188713-19188735 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154806234 18:19190749-19190771 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154806429 18:19193460-19193482 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154806479 18:19194135-19194157 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154806628 18:19196170-19196192 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154806823 18:19198881-19198903 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154807164 18:19203465-19203487 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154807534 18:19208553-19208575 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154807711 18:19210928-19210950 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154807884 18:19213302-19213324 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154808205 18:19217709-19217731 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154808496 18:19221781-19221803 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154808798 18:19225851-19225873 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154808999 18:19228561-19228583 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154809144 18:19230597-19230619 CAGTTCCAGATACTACAAAACGG - Intergenic
1154809881 18:19240783-19240805 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154810027 18:19242818-19242840 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154810327 18:19246886-19246908 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154810476 18:19248921-19248943 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154810869 18:19254354-19254376 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154810920 18:19255029-19255051 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154811122 18:19257904-19257926 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154811270 18:19259939-19259961 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154811415 18:19261974-19261996 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154811565 18:19264008-19264030 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154811913 18:19268753-19268775 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154812062 18:19270788-19270810 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154812239 18:19273165-19273187 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154812504 18:19276893-19276915 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154812796 18:19280970-19280992 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154812983 18:19283511-19283533 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154813143 18:19285714-19285736 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154813261 18:19287407-19287429 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154814269 18:19301152-19301174 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154814649 18:19306409-19306431 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154814799 18:19308442-19308464 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154814950 18:19310477-19310499 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154815199 18:19313874-19313896 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154815348 18:19315909-19315931 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154815454 18:19317431-19317453 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154815606 18:19319466-19319488 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154815730 18:19321160-19321182 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154815881 18:19323195-19323217 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154816122 18:19326589-19326611 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154816374 18:19329984-19330006 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154816525 18:19332020-19332042 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154816578 18:19332695-19332717 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154816747 18:19335063-19335085 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154816897 18:19337100-19337122 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154817045 18:19339136-19339158 CAGTTCCAGATACTACAAAACGG - Intergenic
1154817328 18:19343038-19343060 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154817364 18:19343542-19343564 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154817510 18:19345579-19345601 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154817652 18:19347681-19347703 CAGTTCCAGATACTACAAAACGG - Intergenic
1154817800 18:19349713-19349735 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154817851 18:19350389-19350411 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154818239 18:19355815-19355837 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154818353 18:19357508-19357530 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154818500 18:19359544-19359566 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154818645 18:19361580-19361602 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154818769 18:19363278-19363300 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154818915 18:19365314-19365336 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154819129 18:19368196-19368218 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154820153 18:19382113-19382135 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154820340 18:19384825-19384847 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154820487 18:19386863-19386885 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154820877 18:19392284-19392306 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154821029 18:19394316-19394338 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154821153 18:19396014-19396036 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154821298 18:19398046-19398068 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154821423 18:19399744-19399766 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154821573 18:19401779-19401801 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154821928 18:19406702-19406724 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154822076 18:19408739-19408761 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154822592 18:19415866-19415888 CAGTTCCAGATACTACAAAACGG - Intergenic
1154822618 18:19416205-19416227 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154823044 18:19422137-19422159 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154823166 18:19423834-19423856 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154823317 18:19425870-19425892 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154823463 18:19427905-19427927 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154823661 18:19430612-19430634 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154823783 18:19432304-19432326 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154824038 18:19435868-19435890 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154824190 18:19437903-19437925 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154824485 18:19441973-19441995 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154824605 18:19443666-19443688 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154824822 18:19446715-19446737 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154824972 18:19448751-19448773 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154825139 18:19451120-19451142 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154825393 18:19454682-19454704 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154825535 18:19456550-19456572 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154825560 18:19456887-19456909 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154825711 18:19458922-19458944 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154825859 18:19460961-19460983 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154826115 18:19464525-19464547 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154826329 18:19467578-19467600 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154826492 18:19469784-19469806 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154826629 18:19471817-19471839 CAGTTCCAGATACTACAAAACGG - Intergenic
1154826823 18:19474698-19474720 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154826970 18:19476734-19476756 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154827312 18:19481487-19481509 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154827464 18:19483522-19483544 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154827731 18:19487251-19487273 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154827966 18:19490641-19490663 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154828137 18:19493018-19493040 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154828311 18:19495387-19495409 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154828620 18:19499629-19499651 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154828769 18:19501664-19501686 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154829030 18:19505394-19505416 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154829541 18:19512518-19512540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154829690 18:19514554-19514576 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154829838 18:19516590-19516612 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154829986 18:19518625-19518647 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154830136 18:19520660-19520682 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154830189 18:19521335-19521357 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154830374 18:19524050-19524072 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154830425 18:19524725-19524747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154830723 18:19528798-19528820 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154831050 18:19533210-19533232 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154831353 18:19537280-19537302 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154831420 18:19538123-19538145 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154831570 18:19540163-19540185 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154831719 18:19542200-19542222 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154831853 18:19544064-19544086 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154832102 18:19547626-19547648 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154832250 18:19549660-19549682 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154832630 18:19554920-19554942 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154832905 18:19558653-19558675 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154833054 18:19560688-19560710 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154833206 18:19562723-19562745 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154833355 18:19564757-19564779 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154833599 18:19568152-19568174 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154833744 18:19570189-19570211 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834010 18:19573916-19573938 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834276 18:19577648-19577670 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834426 18:19579680-19579702 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834477 18:19580355-19580377 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834627 18:19582390-19582412 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834750 18:19584085-19584107 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154834901 18:19586122-19586144 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154835048 18:19588157-19588179 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154835169 18:19589854-19589876 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154835316 18:19591889-19591911 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154835613 18:19595960-19595982 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154835908 18:19600033-19600055 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154836055 18:19602068-19602090 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154836178 18:19603766-19603788 CAGTTCCAGATACTACAAAACGG - Intergenic
1154836351 18:19606140-19606162 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154836477 18:19607837-19607859 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154836627 18:19609872-19609894 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154836891 18:19613604-19613626 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154837045 18:19615640-19615662 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154837245 18:19618359-19618381 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154837677 18:19624474-19624496 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154837727 18:19625149-19625171 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154837777 18:19625824-19625846 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154838138 18:19630751-19630773 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154838285 18:19632787-19632809 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154838432 18:19634822-19634844 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154838483 18:19635497-19635519 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154838633 18:19637532-19637554 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154838892 18:19641094-19641116 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154839161 18:19644827-19644849 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154839360 18:19647541-19647563 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154839505 18:19649575-19649597 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154839944 18:19655681-19655703 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154840734 18:19666531-19666553 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154841036 18:19670602-19670624 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154841284 18:19673999-19674021 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154841416 18:19675861-19675883 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154841546 18:19677725-19677747 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154841648 18:19679076-19679098 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154841806 18:19681277-19681299 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154842086 18:19685007-19685029 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154842230 18:19687043-19687065 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154842511 18:19690946-19690968 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154842662 18:19692983-19693005 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154842823 18:19695183-19695205 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154842972 18:19697218-19697240 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154843121 18:19699253-19699275 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154843271 18:19701288-19701310 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154843420 18:19703323-19703345 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154843564 18:19705352-19705374 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154843697 18:19707216-19707238 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154843985 18:19710943-19710965 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154844025 18:19711451-19711473 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154844617 18:19719594-19719616 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154844740 18:19721288-19721310 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154844766 18:19721624-19721646 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154845016 18:19725019-19725041 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154845236 18:19728077-19728099 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154845382 18:19730111-19730133 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154845531 18:19732150-19732172 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154845796 18:19735883-19735905 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846087 18:19739948-19739970 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846239 18:19741983-19742005 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846388 18:19744021-19744043 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846537 18:19746057-19746079 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846683 18:19748092-19748114 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846835 18:19750127-19750149 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154846987 18:19752162-19752184 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154847131 18:19754192-19754214 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154847277 18:19756227-19756249 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154847897 18:19764878-19764900 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154848044 18:19766916-19766938 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154848191 18:19768951-19768973 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154848338 18:19770986-19771008 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154848484 18:19773022-19773044 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154848680 18:19775732-19775754 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154849197 18:19782859-19782881 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154849345 18:19784894-19784916 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154849396 18:19785569-19785591 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154849693 18:19789637-19789659 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154850061 18:19794727-19794749 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154850211 18:19796762-19796784 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154850364 18:19798801-19798823 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154850613 18:19802197-19802219 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154850764 18:19804229-19804251 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154850816 18:19804904-19804926 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154851112 18:19808975-19808997 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154851254 18:19811008-19811030 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154851401 18:19813043-19813065 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154851548 18:19815078-19815100 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154851641 18:19816435-19816457 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154851815 18:19818808-19818830 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154852012 18:19821521-19821543 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154852434 18:19827456-19827478 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154852608 18:19829832-19829854 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154852731 18:19831530-19831552 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154853029 18:19835601-19835623 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154853150 18:19837297-19837319 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154853299 18:19839332-19839354 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154853446 18:19841367-19841389 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154853566 18:19843065-19843087 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154854044 18:19849844-19849866 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154854293 18:19853239-19853261 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154854537 18:19856630-19856652 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154854792 18:19860192-19860214 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154855056 18:19863926-19863948 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154855323 18:19867655-19867677 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154855470 18:19869690-19869712 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154855741 18:19873424-19873446 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154855998 18:19876986-19877008 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154856118 18:19878678-19878700 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154856267 18:19880712-19880734 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154856721 18:19886986-19887008 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154856874 18:19889021-19889043 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154857023 18:19891056-19891078 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154857173 18:19893093-19893115 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154857341 18:19895465-19895487 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154857519 18:19897837-19897859 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154857571 18:19898512-19898534 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154857721 18:19900547-19900569 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154858019 18:19904617-19904639 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154858170 18:19906648-19906670 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154858318 18:19908683-19908705 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154858767 18:19915123-19915145 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154858886 18:19916817-19916839 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859255 18:19922075-19922097 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859308 18:19922751-19922773 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859434 18:19924450-19924472 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859592 18:19926485-19926507 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859712 18:19928179-19928201 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859830 18:19929872-19929894 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154859974 18:19931908-19931930 CAGTTCCAGATACTACAAAACGG - Intergenic
1154860226 18:19935470-19935492 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154860358 18:19937333-19937355 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154860483 18:19939030-19939052 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154860509 18:19939368-19939390 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154860816 18:19943600-19943622 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154860951 18:19945463-19945485 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154861334 18:19950892-19950914 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154861458 18:19952589-19952611 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154861509 18:19953264-19953286 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154861536 18:19953601-19953623 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154861949 18:19959369-19959391 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154862100 18:19961405-19961427 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154862251 18:19963440-19963462 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154862397 18:19965475-19965497 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154862695 18:19969545-19969567 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154863094 18:19974973-19974995 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154863465 18:19980227-19980249 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154863727 18:19983950-19983972 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154863970 18:19987341-19987363 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154864130 18:19989547-19989569 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154864381 18:19992942-19992964 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154864802 18:19998709-19998731 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154864855 18:19999384-19999406 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154865014 18:20001586-20001608 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154865242 18:20004810-20004832 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154865270 18:20005148-20005170 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154865673 18:20010750-20010772 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154865822 18:20012784-20012806 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154866271 18:20018891-20018913 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154866565 18:20022961-20022983 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154866718 18:20024996-20025018 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154866871 18:20027032-20027054 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154867003 18:20028896-20028918 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154867155 18:20030931-20030953 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154867486 18:20035689-20035711 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154867522 18:20036193-20036215 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154867775 18:20039587-20039609 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154867840 18:20040429-20040451 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154868138 18:20044499-20044521 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154868287 18:20046534-20046556 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154868519 18:20049758-20049780 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154869109 18:20057892-20057914 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154869254 18:20059923-20059945 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154869955 18:20069598-20069620 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154870115 18:20071800-20071822 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154870414 18:20075871-20075893 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154870993 18:20084012-20084034 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154871290 18:20088084-20088106 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154871588 18:20092154-20092176 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154871841 18:20095718-20095740 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872134 18:20099788-20099810 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872283 18:20101826-20101848 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872335 18:20102502-20102524 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872484 18:20104537-20104559 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872633 18:20106572-20106594 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872784 18:20108608-20108630 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154872934 18:20110643-20110665 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154873058 18:20112340-20112362 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154873347 18:20116409-20116431 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154873601 18:20119968-20119990 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154874001 18:20125568-20125590 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154874295 18:20129640-20129662 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154874911 18:20138292-20138314 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154874973 18:20139134-20139156 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154875125 18:20141168-20141190 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154875713 18:20149312-20149334 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154876015 18:20153385-20153407 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154876456 18:20159491-20159513 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154876518 18:20160333-20160355 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154876806 18:20164232-20164254 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154876836 18:20164571-20164593 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154877222 18:20169831-20169853 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154877500 18:20173731-20173753 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154877651 18:20175766-20175788 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154877797 18:20177803-20177825 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154877996 18:20180513-20180535 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154878140 18:20182548-20182570 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154878266 18:20184245-20184267 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154878387 18:20185943-20185965 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154878532 18:20187978-20188000 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154878682 18:20190013-20190035 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154879266 18:20198147-20198169 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154879294 18:20198485-20198507 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154879416 18:20200183-20200205 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154879479 18:20201025-20201047 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154879632 18:20203061-20203083 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154880032 18:20208496-20208518 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154880181 18:20210532-20210554 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154880330 18:20212567-20212589 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154880583 18:20215962-20215984 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154880612 18:20216299-20216321 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154880966 18:20221387-20221409 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154881044 18:20222404-20222426 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154881188 18:20224439-20224461 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154881340 18:20226475-20226497 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154881864 18:20233763-20233785 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154882074 18:20236641-20236663 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154882224 18:20238676-20238698 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154882373 18:20240713-20240735 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154882723 18:20245635-20245657 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154882972 18:20249030-20249052 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154883118 18:20251066-20251088 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154883530 18:20256830-20256852 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154883770 18:20260223-20260245 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154883905 18:20262087-20262109 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884054 18:20264122-20264144 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884119 18:20264964-20264986 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884267 18:20266999-20267021 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884391 18:20268696-20268718 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884541 18:20270729-20270751 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884665 18:20272427-20272449 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154884716 18:20273103-20273125 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154885109 18:20278537-20278559 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154885264 18:20280570-20280592 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154885415 18:20282605-20282627 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154885566 18:20284643-20284665 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154885861 18:20288714-20288736 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154886646 18:20299739-20299761 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154886779 18:20301603-20301625 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154887142 18:20306691-20306713 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154887288 18:20308726-20308748 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154887720 18:20314819-20314841 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154887844 18:20316518-20316540 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154888113 18:20320251-20320273 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154888287 18:20322622-20322644 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154888439 18:20324659-20324681 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154888588 18:20326694-20326716 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154888743 18:20328728-20328750 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154888905 18:20330928-20330950 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889026 18:20332625-20332647 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889179 18:20334659-20334681 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889306 18:20336354-20336376 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889457 18:20338390-20338412 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889508 18:20339065-20339087 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889536 18:20339402-20339424 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889733 18:20342113-20342135 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889857 18:20343810-20343832 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889881 18:20344147-20344169 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889934 18:20344822-20344844 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154889995 18:20345664-20345686 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890090 18:20347020-20347042 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890117 18:20347357-20347379 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890263 18:20349392-20349414 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890315 18:20350068-20350090 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890459 18:20352102-20352124 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890606 18:20354137-20354159 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154890753 18:20356171-20356193 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154891005 18:20359735-20359757 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154891154 18:20361770-20361792 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154891597 18:20367869-20367891 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154891892 18:20371938-20371960 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154892186 18:20376000-20376022 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154892334 18:20378036-20378058 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154892469 18:20379900-20379922 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154892620 18:20381935-20381957 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154892815 18:20384652-20384674 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154893297 18:20391433-20391455 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154893444 18:20393469-20393491 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154893594 18:20395504-20395526 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154893747 18:20397536-20397558 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154893906 18:20399571-20399593 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154894057 18:20401608-20401630 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154894120 18:20402450-20402472 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154894522 18:20408048-20408070 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154894673 18:20410083-20410105 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154894794 18:20411780-20411802 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154894939 18:20413812-20413834 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154895078 18:20415843-20415865 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154895228 18:20417876-20417898 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154895374 18:20419910-20419932 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154895626 18:20423472-20423494 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154895921 18:20427543-20427565 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154896047 18:20429241-20429263 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154896199 18:20431276-20431298 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154896350 18:20433311-20433333 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154896645 18:20437383-20437405 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154897054 18:20443138-20443160 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154897115 18:20443980-20444002 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154897249 18:20445679-20445701 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154897399 18:20447715-20447737 CAGTTCCAGATACTACAAAACGG - Intergenic
1154897546 18:20449753-20449775 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154897697 18:20451788-20451810 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154897942 18:20455178-20455200 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898092 18:20457213-20457235 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898244 18:20459250-20459272 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898393 18:20461286-20461308 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898540 18:20463323-20463345 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898679 18:20465359-20465381 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898831 18:20467394-20467416 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154898983 18:20469430-20469452 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154899132 18:20471465-20471487 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154899329 18:20474176-20474198 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154899480 18:20476211-20476233 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154899631 18:20478246-20478268 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154899786 18:20480282-20480304 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154899936 18:20482320-20482342 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154900086 18:20484355-20484377 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154900373 18:20488424-20488446 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154900466 18:20489779-20489801 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154900611 18:20491817-20491839 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154901158 18:20499446-20499468 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154901464 18:20503517-20503539 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154901614 18:20505554-20505576 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154901763 18:20507589-20507611 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154901913 18:20509624-20509646 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154902329 18:20515393-20515415 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154902478 18:20517428-20517450 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154902737 18:20520990-20521012 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154902991 18:20524384-20524406 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154903438 18:20530490-20530512 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154903588 18:20532525-20532547 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154903739 18:20534556-20534578 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154903891 18:20536591-20536613 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154904189 18:20540662-20540684 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154904335 18:20542697-20542719 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154904490 18:20544733-20544755 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154904746 18:20548297-20548319 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154905051 18:20552534-20552556 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154905186 18:20554399-20554421 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154905335 18:20556434-20556456 CAGTTCCAGATACTACAAAAGGG - Intergenic
1154905485 18:20558469-20558491 CAGTTCCAGATACTACAAAAGGG - Intergenic
1156044781 18:32865402-32865424 TTGTAAAAGCTACCACAAAAGGG + Intergenic
1159055058 18:63455090-63455112 CAGTGACAGCTTCAACAAGATGG + Intergenic
1160305484 18:77730716-77730738 CAGTGGCATCTACAACAAAATGG + Intergenic
1165359257 19:35324773-35324795 TACTGATAGATACTACAACATGG - Intronic
1165610526 19:37147832-37147854 TATTGACACTTACTACAACATGG - Exonic
1167881642 19:52463850-52463872 TAGTCACAGCTTCTTCCAAAGGG + Intronic
925796593 2:7551896-7551918 TAGTGATAGATGCAACAAAATGG - Intergenic
926407002 2:12564560-12564582 GAGTCACAGCTACTAAAGAATGG - Intergenic
927346184 2:22044308-22044330 TATTGACACATACTTCAAAATGG + Intergenic
928160040 2:28914587-28914609 TAATAGCAGCTACTGCAAAAAGG - Intronic
928277085 2:29912338-29912360 TATTGAAAGCAATTACAAAAAGG + Intronic
928589459 2:32799067-32799089 TTGTGACACATGCTACAAAATGG + Intronic
929965452 2:46531337-46531359 TACTGACAGCTGCTACAATGTGG - Intronic
932035170 2:68238175-68238197 AAGTGACAGATACCACAACAGGG + Intronic
937068637 2:119043090-119043112 TAAAGACAGCTACTATCAAAAGG - Intergenic
937740058 2:125340388-125340410 TTGAGACAGCTACTACATTAAGG + Intergenic
939015856 2:136903135-136903157 TATTGACAGCTACCCCAAAAAGG + Intronic
939596113 2:144124875-144124897 CAATGACAGTTACTAAAAAACGG + Intronic
939904419 2:147893213-147893235 TAGTGATACCTACAACAAAATGG - Intronic
940247327 2:151633836-151633858 GAGTGACAGGGAGTACAAAAAGG - Exonic
940465836 2:154025366-154025388 TAGTGAAAGCTACTTCCAGATGG - Intronic
941426550 2:165353230-165353252 TAGTGAGAAATACTATAAAATGG - Intronic
942091603 2:172496995-172497017 TGGTGCCATCTTCTACAAAAAGG - Intronic
944466163 2:200001937-200001959 TGGTGTCACCTACTCCAAAAAGG + Intronic
945317433 2:208385141-208385163 TAAAGAAAGGTACTACAAAAAGG - Intronic
945830399 2:214777740-214777762 AAGTTAAAGCTACTATAAAATGG - Intronic
947331079 2:229030091-229030113 TTCTGACAGATACTACAACATGG + Intronic
948034174 2:234844540-234844562 CAGTGACTGCTACTAAAAAAGGG + Intergenic
1169408353 20:5345206-5345228 CAGTGAAAGCTAATACAAAGAGG + Intergenic
1169886074 20:10399144-10399166 TGGTGACAGCTACTACAGGCTGG + Intergenic
1169897470 20:10519526-10519548 TACTGACACATACTACAACATGG - Intronic
1171829061 20:29966374-29966396 TACTTACAGATTCTACAAAAAGG - Intergenic
1172076104 20:32298782-32298804 TACCTACAGCTACTCCAAAAAGG - Intronic
1173542043 20:43861129-43861151 GAGTGAAAGCCACTAGAAAATGG - Intergenic
1176153006 20:63602689-63602711 CAGTGAGAGCTGCTCCAAAAAGG - Intronic
1177242145 21:18472945-18472967 TAGTGATAACTACTACAAGATGG + Intronic
1178280179 21:31275401-31275423 TGCTGACAGCTACAACAAAACGG + Intronic
1178991703 21:37362153-37362175 TAGTAACAACAACAACAAAAAGG + Intergenic
1182717342 22:32368221-32368243 TTGTAACTGCTACTTCAAAATGG - Intronic
1183277524 22:36908755-36908777 CAGTGACAGCTCCTTCAAATGGG - Intergenic
1185120895 22:48969347-48969369 TAGTGGCTTCTAATACAAAAGGG + Intergenic
1203335784 22_KI270739v1_random:71210-71232 TAGTTCCAGAAACTACAAAAAGG - Intergenic
949345062 3:3068827-3068849 TAGTAACTGCAACTATAAAATGG + Intronic
949962108 3:9320811-9320833 AAGTGACAGATACTCAAAAAGGG - Intronic
952578965 3:34808230-34808252 TAATTCCAGCTACTCCAAAAGGG + Intergenic
953331395 3:42055988-42056010 TACTGATACCTACTACAACATGG - Intronic
954729542 3:52647661-52647683 TACTGACACATGCTACAAAATGG + Intronic
956162874 3:66373182-66373204 CAGTGGCAGCTACTACATAAAGG - Intronic
956563267 3:70606694-70606716 TAGTGACATATACTGCTAAAAGG - Intergenic
958218072 3:90618786-90618808 CACTCACAGATACTACAAAAAGG + Intergenic
958649428 3:96918414-96918436 TAGTGACAGTTAATATATAAAGG + Intronic
960778727 3:121293150-121293172 TATTGATAACTACTACAACATGG + Intronic
964602802 3:158520971-158520993 TAGTTACAGATACTACAAACTGG + Intronic
965199750 3:165642554-165642576 TAATGACAACTACAACAAAATGG - Intergenic
965478713 3:169189619-169189641 TACTCACAGATACAACAAAAAGG - Intronic
968224225 3:196963110-196963132 TAGTGATACCTGCTACAACACGG - Intronic
970882938 4:20953289-20953311 AACAGACAGATACTACAAAAAGG - Intronic
971271572 4:25152984-25153006 TAATGACATCTACTAGAAATAGG - Intronic
971734943 4:30436018-30436040 TAATGGCAACTACTACTAAATGG + Intergenic
972549411 4:40114534-40114556 TAGTGACACATGCTACAACATGG - Intronic
975452088 4:74540396-74540418 TATTGCCAGCTACTTCAAATAGG - Intergenic
975486432 4:74938380-74938402 TAGTGATAGATACTTCCAAATGG - Intronic
976800438 4:88985122-88985144 TACTGACACATGCTACAAAATGG + Intronic
977259352 4:94780329-94780351 TAGTGACACATGCTACAATATGG - Intronic
977411960 4:96677783-96677805 TAGTTACAGCAATTACAGAATGG - Intergenic
978879027 4:113678102-113678124 TAATGACAACTCTTACAAAAAGG - Intronic
982042831 4:151412040-151412062 CAATGGCATCTACTACAAAATGG - Intronic
982351787 4:154423359-154423381 TGCTGACACGTACTACAAAATGG - Intronic
982968195 4:161943026-161943048 TAGTGATACATAATACAAAATGG + Intronic
984598610 4:181700715-181700737 TAGTGACTGCTACTATAAAGGGG - Intergenic
988318836 5:29666460-29666482 TATTGACACCTACTACGACATGG + Intergenic
991536741 5:67677321-67677343 AAGTGACAGCTTCTACAACATGG - Intergenic
992348337 5:75903343-75903365 GAGTGAGAGGTACCACAAAAAGG + Intergenic
996925334 5:128819547-128819569 TACTGATATGTACTACAAAATGG + Intronic
997136232 5:131329335-131329357 TAATGGCAGCAACAACAAAAGGG - Intronic
997237881 5:132284530-132284552 TAGTGACTTCTAATGCAAAAGGG + Intronic
998161910 5:139817736-139817758 TCCTAACAGCTACTACAAAGTGG - Intronic
998216369 5:140241048-140241070 TAGAAACAGCAGCTACAAAATGG - Intronic
1003140279 6:3465647-3465669 TAGGGACACCTACTAGAAAGTGG - Intergenic
1003212025 6:4077411-4077433 GAGCAACAGCTACAACAAAATGG - Exonic
1005472262 6:26172680-26172702 TATTTACAGCTACTAGAGAAGGG - Intergenic
1007557551 6:42779738-42779760 TAGTCCCAGCTACTACAGAGAGG - Intronic
1008333649 6:50273671-50273693 TAATGTCAGCTAATTCAAAATGG + Intergenic
1008980307 6:57475508-57475530 TACTGACATATGCTACAAAATGG - Intronic
1009076771 6:58713587-58713609 CACTTACAGCTACTACAAGAAGG - Intergenic
1009084419 6:58820033-58820055 TACTTGCAGCTACTACAAGAAGG - Intergenic
1009095592 6:58975864-58975886 TACTTGCAGCTACTACAAGAAGG - Intergenic
1009129350 6:59445294-59445316 TACTTGCAGCTACTACAAGAAGG - Intergenic
1009153981 6:59787649-59787671 TACTTGCAGCTACTACAAGAAGG - Intergenic
1009168413 6:60368451-60368473 TACTGACATATGCTACAAAATGG - Intergenic
1009589697 6:65651166-65651188 TAGAGAAAGCTACTCCAAATGGG + Intronic
1009962946 6:70545632-70545654 TAGTCACAATTACTAGAAAATGG - Intronic
1011336344 6:86265324-86265346 TAGTGAAAGCTATTTCAAATGGG - Intergenic
1012334151 6:98032842-98032864 TAGGGACAGCTTCTTTAAAAAGG + Intergenic
1012503608 6:99918896-99918918 TTGGGACTGCTACTAGAAAAAGG + Intergenic
1014181890 6:118393386-118393408 TACTGACAGCTGCTACCACATGG - Intergenic
1015097513 6:129433104-129433126 TTGTGACAGCTACTAGGGAAAGG + Intronic
1015357924 6:132301751-132301773 TAGTGTCAGTTACTCCAACATGG - Intronic
1016228139 6:141767341-141767363 TATTTACAGCTATTACAAATGGG + Intergenic
1016451990 6:144192787-144192809 TAATGACAACAACAACAAAAAGG - Intergenic
1017848162 6:158277712-158277734 AAGTGACAGCTTCCACACAAAGG - Intronic
1018049378 6:159996110-159996132 TTGAGAAAGCTACCACAAAAAGG - Intronic
1018374355 6:163196478-163196500 GAGTGACAGCTACTTCAGCAGGG + Intronic
1019968129 7:4517630-4517652 TTGTGACAGCAACAACAGAAAGG + Intergenic
1020997550 7:15281923-15281945 CTGAGAAAGCTACTACAAAAAGG + Intronic
1021889047 7:25169532-25169554 TATGGACACATACTACAAAATGG - Intronic
1022059371 7:26776068-26776090 TAGTGTCAGCTACTTGAGAAAGG - Intronic
1022105793 7:27196654-27196676 AAGTGTCAGGTATTACAAAAGGG - Exonic
1022267999 7:28776852-28776874 TACTGACACATACTACAACATGG - Intronic
1024180055 7:46882852-46882874 TACTGACATATACTACAACATGG + Intergenic
1026433398 7:70370489-70370511 TACTGACATATACTACAACATGG - Intronic
1026606742 7:71822929-71822951 TAGGGACAGTTATTAAAAAATGG - Intronic
1029895443 7:103978431-103978453 TAGTGACTGCTTCTACAGGATGG + Intronic
1031068570 7:117135931-117135953 TTGTGTCAGCAACTACAAACAGG + Intronic
1031824025 7:126540614-126540636 TATTGACACCTACTACAAAATGG + Intronic
1033113227 7:138601838-138601860 TAGAGAGAGCTTCTACAATAGGG - Intronic
1040346290 8:46500866-46500888 CAGAGACAGATGCTACAAAACGG + Intergenic
1040893000 8:52336901-52336923 TTGTGACAGAAACTACAGAAGGG - Intronic
1042204180 8:66311706-66311728 TTGTGACAGCTGCTGCAAATGGG + Intergenic
1045937983 8:107705128-107705150 GAGTGTCAGCTACTCCATAAAGG + Intergenic
1046533257 8:115474121-115474143 TACTCACAAATACTACAAAAAGG - Intronic
1046549201 8:115691592-115691614 GAGTGACAAGTATTACAAAATGG - Intronic
1047440030 8:124869687-124869709 TTCTGACAGCTCCTACAAGAAGG + Intergenic
1048180629 8:132191256-132191278 TAGTCCCAGCTACTACAGATGGG - Intronic
1048338848 8:133523498-133523520 AAGTGGCAGCTACTTCAAAGGGG + Intronic
1048610357 8:136015568-136015590 CAGTGACACATACTATAAAATGG - Intergenic
1050859208 9:10403729-10403751 AAGTGAAAGCCAATACAAAAAGG + Intronic
1051158751 9:14181933-14181955 TAGTTACAGCAACTTCAAAATGG + Intronic
1051278734 9:15421143-15421165 TACTGACACATACTACAAAATGG + Intergenic
1051927257 9:22343905-22343927 TCCTGACAGCTAAGACAAAAAGG + Intergenic
1054801062 9:69348767-69348789 TACTGACAGATACTATAACATGG - Intronic
1055605623 9:77967501-77967523 TACTGACACATACTACAACATGG + Intronic
1056334857 9:85558170-85558192 TAGTGACACATGCTACAATATGG + Intronic
1057406723 9:94778462-94778484 TAGTGACACCTGCAACAATATGG + Intronic
1059468763 9:114487744-114487766 TAGATACAGGAACTACAAAAGGG - Intronic
1060124810 9:121033405-121033427 GAGTAGAAGCTACTACAAAAAGG - Intronic
1060654760 9:125362974-125362996 TAGAGACTAGTACTACAAAAAGG + Exonic
1061495021 9:130968610-130968632 TATTGGCACCTACTACAACATGG + Intergenic
1189719248 X:43898498-43898520 TGGTGACAGTTCCTAGAAAATGG + Intergenic
1192040137 X:67611391-67611413 TAGTAACAGCAACAACAAATAGG - Intronic
1193935565 X:87615662-87615684 TAGTAATAGATACTACAACATGG + Intronic
1194432817 X:93831606-93831628 TGATGACAGCTAATACAAGAAGG + Intergenic
1194700511 X:97108129-97108151 TAGTGAGAGCAACTACAAGTGGG - Intronic
1195448958 X:104987770-104987792 TTGTGACAGCAAATACAAATGGG + Intronic
1197418996 X:126214037-126214059 TCCTCACAGATACTACAAAATGG + Intergenic
1201329695 Y:12804165-12804187 TTGTCACAGCAACCACAAAAGGG - Intronic
1202339697 Y:23850319-23850341 CAGTGAGAGCTACTTCAAAAGGG - Intergenic
1202531069 Y:25819763-25819785 CAGTGAGAGCTACTTCAAAAGGG + Intergenic