ID: 1075704916

View in Genome Browser
Species Human (GRCh38)
Location 10:124494785-124494807
Sequence ACAGACAAACTTTAAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075704916_1075704928 28 Left 1075704916 10:124494785-124494807 CCTGCCCTTTAAAGTTTGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1075704928 10:124494836-124494858 GAGTCCCTGTGGAGCAGGCTGGG No data
1075704916_1075704926 23 Left 1075704916 10:124494785-124494807 CCTGCCCTTTAAAGTTTGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1075704926 10:124494831-124494853 ACTGTGAGTCCCTGTGGAGCAGG No data
1075704916_1075704927 27 Left 1075704916 10:124494785-124494807 CCTGCCCTTTAAAGTTTGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1075704927 10:124494835-124494857 TGAGTCCCTGTGGAGCAGGCTGG No data
1075704916_1075704929 29 Left 1075704916 10:124494785-124494807 CCTGCCCTTTAAAGTTTGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1075704929 10:124494837-124494859 AGTCCCTGTGGAGCAGGCTGGGG No data
1075704916_1075704924 17 Left 1075704916 10:124494785-124494807 CCTGCCCTTTAAAGTTTGTCTGT 0: 1
1: 0
2: 0
3: 12
4: 204
Right 1075704924 10:124494825-124494847 CACCAGACTGTGAGTCCCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075704916 Original CRISPR ACAGACAAACTTTAAAGGGC AGG (reversed) Intronic
904545359 1:31266330-31266352 AAAGAGAAACTCTAAAGGGGAGG + Intronic
904842024 1:33379109-33379131 ACAGAAAAACTGTACAGGCCAGG + Intronic
904933115 1:34106267-34106289 ACAGACAAACCTAGAAGGACTGG + Intronic
906706819 1:47901033-47901055 ACAGACAATCATAAAAGGGTGGG + Intronic
907112056 1:51935412-51935434 ACAGACAAAACTCAAAGGCCAGG + Intronic
908283965 1:62573216-62573238 AAAGAGAAAATTCAAAGGGCTGG + Intronic
909125907 1:71669262-71669284 CCAGACACACTTTAAATAGCAGG - Intronic
909840782 1:80320555-80320577 AAAGATAAAATTTAAAGGCCGGG + Intergenic
911616087 1:100012817-100012839 ACAGAAAACATTTAGAGGGCTGG + Intronic
912305084 1:108559487-108559509 ACAGACAAATTTTTAAAGGGAGG + Intergenic
912637753 1:111314497-111314519 ACAGATAAACTTCAAAAGTCAGG - Intronic
913475572 1:119233919-119233941 ACAGGCAAACTTTTAATGTCAGG + Intergenic
913970627 1:143412970-143412992 AGAAAGAAACTATAAAGGGCTGG - Intergenic
914065003 1:144238581-144238603 AGAAAGAAACTATAAAGGGCTGG - Intergenic
914114148 1:144727773-144727795 AGAAAGAAACTATAAAGGGCTGG + Intergenic
915825341 1:159069903-159069925 ACAGAGAATCTTCAGAGGGCAGG - Intronic
915847879 1:159287202-159287224 ACAAACACACTGTAAAAGGCAGG + Intergenic
917230231 1:172828622-172828644 AGAGAGAAATTATAAAGGGCAGG + Intergenic
923112651 1:230904560-230904582 AAAAACTAACTTTAAAGGCCGGG - Intergenic
1065093443 10:22258537-22258559 ACAGACAAACATTAAAATGCAGG - Intergenic
1068859903 10:61837403-61837425 ACAAACAACCTTTATATGGCTGG + Intergenic
1072312659 10:94171558-94171580 ACAGACAAACCTAGAAGGGGAGG - Intronic
1073957150 10:108885979-108886001 ACAGAAAATTTTTAAAGGTCAGG - Intergenic
1075135040 10:119777064-119777086 AAAAACAATTTTTAAAGGGCTGG + Intronic
1075704916 10:124494785-124494807 ACAGACAAACTTTAAAGGGCAGG - Intronic
1076885344 10:133259621-133259643 AGAGACAAACTCCAAAGGCCAGG - Intergenic
1079794445 11:24782208-24782230 ACTGAGTAACTTTAAAGTGCTGG + Intronic
1080051748 11:27865209-27865231 ACAGACAAACTTTGATGCTCAGG + Intergenic
1080466157 11:32499289-32499311 ACAGAAAAACATCAGAGGGCAGG + Intergenic
1081940929 11:46941279-46941301 AGAGACAAATTGTAAAAGGCAGG - Intronic
1083537451 11:63482884-63482906 ACACATAAACTTAAAAGGGGAGG + Intronic
1084670058 11:70600824-70600846 AAAGACAAACTTTAAACTCCTGG + Intronic
1085000986 11:73034236-73034258 AAAGAAAAACCTTAAAGGGGAGG - Intronic
1085154157 11:74278097-74278119 AGAAACAGACTTTAAAGTGCTGG + Intronic
1085234136 11:74999108-74999130 ACAGTTAAAATTTAAAAGGCTGG - Intronic
1086025817 11:82290151-82290173 ACAAACAAACAAAAAAGGGCAGG - Intergenic
1086423995 11:86666000-86666022 ACAGATAAATTTTTAAAGGCTGG + Intronic
1088358342 11:108966409-108966431 ACAGAGAGCCTCTAAAGGGCTGG - Intergenic
1089026841 11:115279600-115279622 AAAGAAAAACATTTAAGGGCTGG + Intronic
1089099825 11:115952961-115952983 AAAGACACACTTGAGAGGGCAGG - Intergenic
1090683760 11:129091385-129091407 AAATAAAAACTTTTAAGGGCAGG + Intronic
1093290161 12:17309817-17309839 ACAAACAAACATTGAAGGGTAGG - Intergenic
1093564483 12:20586285-20586307 TCAGACTAACTTTAAAGGGGAGG - Intronic
1095492515 12:42749270-42749292 AAAGACAAACTTGAAAGTGAGGG + Intergenic
1096331003 12:50712610-50712632 ACAAACAAACGAAAAAGGGCTGG + Intronic
1096570294 12:52519244-52519266 ACAGAAAAGCTTTAGAGGGACGG - Intronic
1098283831 12:68888068-68888090 AGAAACAAACTTTAAAAGCCAGG - Intronic
1099454253 12:82844929-82844951 ATAGAAAAACTGTAAGGGGCCGG + Intronic
1099466633 12:82995931-82995953 AAAGAGCAATTTTAAAGGGCTGG - Intronic
1100054553 12:90492482-90492504 ACATACTGACTTCAAAGGGCAGG - Intergenic
1101235967 12:102790327-102790349 ACAGACAATCTTCAAAAGTCTGG - Intergenic
1102183191 12:110928294-110928316 ACAAACAAACATTAATTGGCCGG - Intergenic
1104250761 12:127091287-127091309 ACAGACAAACAATAGATGGCTGG - Intergenic
1105568880 13:21580357-21580379 ACATACATACTTTTAAGGGTAGG + Intronic
1105657396 13:22456000-22456022 AATGACAAATTTTAAAAGGCAGG - Intergenic
1110156064 13:72318146-72318168 AGAGAGAAACTTTAAATGGAAGG + Intergenic
1110448478 13:75615588-75615610 ACAGACTAAATATAAAGGGATGG - Intergenic
1111272068 13:85898762-85898784 ACAGAAAAACAAAAAAGGGCAGG + Intergenic
1112187843 13:97144994-97145016 ACAGACAAAATTTAAATTGGTGG - Intergenic
1115568520 14:34645956-34645978 ACAGACAATTTTAAAAGGCCAGG - Intergenic
1119247327 14:73123051-73123073 ACAGAAAAAATTTTCAGGGCTGG - Exonic
1120191163 14:81441008-81441030 ACAGCCAAATTCTAAAGGGTTGG + Intergenic
1124932460 15:34135211-34135233 ACAGACAAACATAACAGGCCAGG + Intergenic
1126330667 15:47527460-47527482 ACAGAAAATCTTTGAAAGGCTGG - Intronic
1128375857 15:67075365-67075387 ACACACAAAATGTAAAGGGTTGG - Intronic
1128668148 15:69553651-69553673 ACAGACAGACTTTACAGTTCTGG + Intergenic
1129437582 15:75554487-75554509 ACAAAAAAATTTTAAAGGCCAGG - Intronic
1133396517 16:5451805-5451827 AAAGTAAAACTTGAAAGGGCTGG - Intergenic
1137264006 16:46853809-46853831 ACAGACAGACATTTAAGGGCAGG - Intergenic
1137662995 16:50225975-50225997 AAAGAAAAACGTTAAAGGCCAGG - Intronic
1138132992 16:54498178-54498200 CCAGACAAACTATCAAGGGTTGG + Intergenic
1139384176 16:66553588-66553610 ACAGAGAAACCTTACAGGGAAGG + Intronic
1142699469 17:1650259-1650281 ACACAGAAAGCTTAAAGGGCTGG + Intergenic
1145256664 17:21327818-21327840 CCAGAGAAATTTTAAAGGACAGG + Intergenic
1145319947 17:21760129-21760151 CCAGAGAAATTTTAAAGGACAGG - Intergenic
1147236047 17:39058346-39058368 ACAGAAAAAATTTAAAGATCAGG + Intergenic
1147265734 17:39233287-39233309 ACAGAAAAATTTTGTAGGGCCGG + Intergenic
1147289021 17:39426469-39426491 ACAAACAAACAATAAAGGGATGG + Intronic
1147302605 17:39541764-39541786 AGAGAGAAGCTGTAAAGGGCAGG + Intronic
1150173660 17:63026166-63026188 AGAGACAAAATTTAAAAGGGAGG - Intronic
1153639349 18:7142728-7142750 AAAGACAAAATTTAAAAAGCAGG - Intergenic
1154266131 18:12880711-12880733 ACAGACAACATTTAAAAGGATGG - Intronic
1155228872 18:23754745-23754767 AGAGGGATACTTTAAAGGGCTGG + Intronic
1155957533 18:31966446-31966468 CCAGACAAACATAAAAGGACAGG - Intergenic
1157246641 18:46060673-46060695 ACACTCAAACTTTACATGGCAGG + Intronic
1159405409 18:67995720-67995742 ACAAACAAGCTATAAAGGGATGG + Intergenic
1160091241 18:75828651-75828673 ACATAGAAACATTAAAGGTCAGG + Intergenic
1168312541 19:55468154-55468176 ACACACAGAATTTCAAGGGCTGG - Intergenic
926812696 2:16770623-16770645 ACAGATACACCTTCAAGGGCAGG - Intergenic
928522822 2:32107000-32107022 ACAGACCAACTCTTCAGGGCTGG - Intronic
929608828 2:43254657-43254679 ACAGCCAAACCTTAAAGGATGGG - Intronic
931175494 2:59850467-59850489 ACAGGCATACTTTGAAGGGGGGG + Intergenic
931941096 2:67253098-67253120 ACAGACAAACCATAACAGGCAGG - Intergenic
932012628 2:67993634-67993656 AGTGACAAACTTTAGAAGGCAGG - Intergenic
933308453 2:80631229-80631251 AAAGATAAACATTAAAGGGCTGG - Intronic
934175322 2:89573896-89573918 AGAAAAAAACTATAAAGGGCTGG - Intergenic
934285639 2:91648259-91648281 AGAAAAAAACTATAAAGGGCTGG - Intergenic
936017068 2:108967454-108967476 AAACACGAACTTTAAAGGCCTGG - Intronic
937611595 2:123868518-123868540 ACTGACCAAACTTAAAGGGCAGG - Intergenic
938858073 2:135336466-135336488 ACAGACTAACTTAAAATGCCAGG + Intronic
939274263 2:139979651-139979673 ACTGAGAAACTTTAAAAGGATGG - Intergenic
944454270 2:199877112-199877134 ACAAACAAACTGAAAAGGGCTGG + Intergenic
944845711 2:203665837-203665859 ACAGACACACTTGAAAGGCATGG + Intergenic
945313289 2:208341288-208341310 AAAAAAAAAGTTTAAAGGGCCGG - Intronic
945519653 2:210809297-210809319 ATAGACAAAAATTAAAGGGATGG - Intergenic
947263357 2:228250237-228250259 ACAGACCAACTTTAAAATTCAGG - Intergenic
947839790 2:233200324-233200346 ACAGACAGACGTGAAAGTGCAGG + Intronic
948554944 2:238802663-238802685 ACAGACAGACTTCACAGAGCAGG + Intergenic
1172993319 20:39051702-39051724 ACACACAAAATTTAAAGAGAAGG + Intergenic
1177140489 21:17352933-17352955 CCACACAAAATTTGAAGGGCTGG - Intergenic
1181942354 22:26488185-26488207 ACACACACACTTCAAATGGCAGG - Exonic
1183155435 22:36071383-36071405 AGAAAAAAACTTTAAACGGCCGG - Intergenic
1183239462 22:36646254-36646276 AAAGAGAAACATTAAAGGACAGG - Intronic
1183895118 22:40962078-40962100 ACAAACAAACCATAAAAGGCTGG - Intronic
1184398251 22:44258311-44258333 ACAAACAAACTTTTAAGTTCAGG + Intronic
955121198 3:56060383-56060405 AATGACAACCTTTAAAGGGTGGG - Intronic
955422891 3:58757462-58757484 AAAGACAAACTATAAAGTGAGGG - Intronic
956228245 3:66983800-66983822 ACAGACTTTCTTTAAAGGGTCGG + Intergenic
960599175 3:119438487-119438509 ACATACAAAGTTTAAACAGCAGG - Intronic
961628085 3:128277432-128277454 ACACCCAAACTTTGAAAGGCTGG - Intronic
964171181 3:153770957-153770979 ACAGACACAAATTAAAGGGAAGG + Intergenic
965386963 3:168056663-168056685 ACAGTCAAACCTTAAAGCTCTGG - Intronic
965642962 3:170850439-170850461 ACAGAGAGACTATAAAGGGTTGG - Intronic
966423074 3:179753122-179753144 ACATAAAAACTTTAAAAGACTGG - Intronic
966525083 3:180911929-180911951 TCAGACAAACTTAATAGAGCAGG - Intronic
966561708 3:181328106-181328128 ACAGAAAAACTTGAAAGATCTGG + Intergenic
967677750 3:192319675-192319697 ACAGAAAAAGTTTAAAGGCAAGG + Intronic
967903554 3:194482810-194482832 ACAAAAAAATTTTAAAGGCCGGG + Intronic
967926112 3:194649386-194649408 ACAGAGAAACTTAAAAGGCCAGG + Intronic
970221326 4:13814972-13814994 ACAAATATACTTTAAAGGCCAGG - Intergenic
970991398 4:22217536-22217558 ATAGACAAACACTAAAGAGCAGG + Intergenic
972770406 4:42192233-42192255 AGAGATAAACTATACAGGGCTGG - Intergenic
973108188 4:46366778-46366800 ACTGAAAAACTTTAAACGGTTGG + Intronic
975406646 4:73998352-73998374 AGAGACACCCTTTATAGGGCAGG + Intronic
977181079 4:93874996-93875018 GGAGGCAAACTGTAAAGGGCAGG - Intergenic
978787153 4:112622601-112622623 ACAGACAGATTTTACAGGGTCGG - Intronic
980601746 4:135036130-135036152 ACAGAAAAACATGAAAAGGCTGG + Intergenic
980689422 4:136275380-136275402 ACAGAACAAATTCAAAGGGCTGG - Intergenic
980832700 4:138151205-138151227 ACAGACAATGTGTATAGGGCAGG + Intergenic
982018936 4:151184297-151184319 ACACACACATTTTAATGGGCTGG + Intronic
982191435 4:152859713-152859735 AAAGACATGCTTTAAAGGGAAGG - Intronic
985443943 4:190009145-190009167 ACAAACAAATTTTAATGGGAAGG - Intergenic
990199275 5:53353121-53353143 ACAGACAAGTTTCAAAGGGCAGG + Intergenic
990840941 5:60078185-60078207 ACACACAAACTTTCAAGGTAGGG - Intronic
991028799 5:62060862-62060884 ATAAACAAATTTTAAAAGGCTGG - Intergenic
991291935 5:65041826-65041848 ACAGAGACACTTAAAGGGGCAGG + Intergenic
995065146 5:107853322-107853344 ACAGAAACATTTGAAAGGGCAGG - Intergenic
997636611 5:135412803-135412825 ACAGACAAACTTTAAATATGAGG - Intergenic
999077147 5:148807127-148807149 ACAAACAATCTTAAAAGAGCTGG + Intergenic
999532922 5:152482019-152482041 ACACACACGCTTTAAAGAGCAGG + Intergenic
1001094496 5:168765905-168765927 ACAGACAAGCTTTAATAGACGGG + Intronic
1002666135 5:180826668-180826690 ACAGAGAAAAATTAAAGGGAAGG + Intergenic
1003494812 6:6654453-6654475 ACAGAGAAACTTTTATGTGCTGG - Intronic
1004547643 6:16613931-16613953 ATAGACAAACTTTTAGGGGTGGG + Intronic
1004547761 6:16615042-16615064 ATAGACAAACTTTTAGGGGTGGG + Intronic
1004579462 6:16934898-16934920 ACAAACAACCTATAAAGGACAGG + Intergenic
1006653982 6:35574603-35574625 ACAGAGAAGCTTGACAGGGCAGG + Exonic
1006788286 6:36682466-36682488 TCACACCAAGTTTAAAGGGCAGG - Intronic
1007821225 6:44561752-44561774 CCACACAAACTTCAAAGGGCTGG + Intergenic
1008586270 6:52953014-52953036 AAAGGAAAACTTTAAAGGGAAGG - Intergenic
1008834568 6:55809801-55809823 ACAGACAAATTTTAGAGGAAAGG + Intronic
1010653602 6:78484503-78484525 AAAGTCAAACTTTAATGGGAAGG + Intergenic
1011252265 6:85384429-85384451 CCAGACATAATTTTAAGGGCTGG + Intergenic
1011465693 6:87654431-87654453 ACACAAAAACTTTTAAGGGCTGG + Intronic
1012062812 6:94510839-94510861 TCAGAGAAACTTTGCAGGGCGGG - Intergenic
1012732111 6:102896088-102896110 ACAGACAAACAGTAAAGGAGGGG - Intergenic
1014910014 6:127080537-127080559 ACAGACAAATTTAAAAGGACAGG - Intergenic
1017298823 6:152833104-152833126 ACAGTGTATCTTTAAAGGGCAGG - Intergenic
1018374984 6:163201989-163202011 AGAGCCAGACTTTGAAGGGCAGG + Intronic
1018627593 6:165794767-165794789 ACAATCATACTTTAAAAGGCAGG + Intronic
1019128100 6:169854614-169854636 ACAGGCAAGCTTTGAGGGGCAGG - Intergenic
1022685919 7:32596234-32596256 ACAAAAAAATTTAAAAGGGCTGG - Intergenic
1022789520 7:33672955-33672977 ACAAACATTCTTTAAAGGGAGGG + Intergenic
1025137709 7:56434155-56434177 ACAGACAAAATATAGAGAGCAGG + Intergenic
1028265817 7:88723869-88723891 AAAGAAAAACTTTAAAAGGATGG + Intergenic
1030197967 7:106871020-106871042 ACAAGTAAACTTTAAAGAGCTGG + Intronic
1030951892 7:115801263-115801285 ACAGATTATCTTTAAAGGGACGG + Intergenic
1032468217 7:132160068-132160090 ACAGACAAACATGGATGGGCAGG - Intronic
1032545439 7:132737845-132737867 CCAGAGAAGCTTTAAAGAGCGGG - Intergenic
1034153419 7:148934956-148934978 AAAAACAAACGTTAAAGGCCAGG - Intergenic
1034397575 7:150838888-150838910 AGAAACAAAATTGAAAGGGCTGG - Intronic
1034604673 7:152301064-152301086 AGAAAAAAACTATAAAGGGCTGG + Intronic
1035900542 8:3454733-3454755 GAAGAAAAAATTTAAAGGGCAGG - Intronic
1036541808 8:9721492-9721514 ACAGACAAAATTAAAAGGTTAGG - Intronic
1036868096 8:12417657-12417679 ACAGAGGAACTCTAAAAGGCAGG + Intergenic
1038245704 8:25853496-25853518 ATAGAAAAACTTAACAGGGCGGG + Intronic
1039200782 8:35091436-35091458 CAAGTAAAACTTTAAAGGGCTGG - Intergenic
1040567058 8:48576769-48576791 ACACACACACTTTAAATGACTGG + Intergenic
1040580168 8:48691341-48691363 AGAGAAAAACTGAAAAGGGCAGG + Intergenic
1040934700 8:52770359-52770381 ACAGCCAACCTTTAAAGGGTGGG + Intergenic
1042245352 8:66704273-66704295 ACAGAAAAAGTTAAAAGAGCTGG + Intronic
1044403703 8:91801604-91801626 AAAGAGAAAGTTTAAAGGGAAGG - Intergenic
1046459931 8:114520140-114520162 GCAGAAAAGCTTGAAAGGGCTGG + Intergenic
1047648860 8:126898529-126898551 ACAGACCAAGGCTAAAGGGCTGG + Intergenic
1047945651 8:129876158-129876180 AGATACTAACTTTAAATGGCAGG - Intronic
1049115960 8:140687838-140687860 AAAAACAAACTTTCCAGGGCAGG + Intronic
1050212389 9:3275701-3275723 AAAAACAAATTTTAAAGGTCAGG + Intronic
1050899155 9:10923305-10923327 ACAGAAGAACATTAAAGGGATGG - Intergenic
1050988326 9:12112230-12112252 ACAGTCAAACTTTAAAAGATTGG + Intergenic
1051017949 9:12503851-12503873 AAGGACAAACTTTACAGGGGAGG + Intergenic
1052296562 9:26902425-26902447 ACATAAAAATTTTAAAAGGCTGG - Intergenic
1055604850 9:77957932-77957954 AGAGACACATTTTAAACGGCAGG + Intronic
1056114291 9:83426756-83426778 ACAGAGAAGCTTTGAAGGGGTGG + Intronic
1056645595 9:88408956-88408978 ACACACAAACACAAAAGGGCCGG - Intronic
1058630444 9:106981021-106981043 AAAGACAGACTTTAAAAGGTGGG - Intronic
1058846173 9:108961740-108961762 AGAAACAAACTCAAAAGGGCAGG + Intronic
1059800007 9:117740578-117740600 ACAGACAAAATGTAAATGACTGG + Intergenic
1061728639 9:132596443-132596465 ACAGATAACATTTAAAGGCCAGG + Intronic
1061803596 9:133126323-133126345 GCAGAGGAACTTTAAAAGGCAGG + Intronic
1062327261 9:136018226-136018248 ACAGAAAAACTCTACAGGGGTGG + Intronic
1186030394 X:5362635-5362657 TCACACTCACTTTAAAGGGCTGG - Intergenic
1186505421 X:10087744-10087766 ACAGAATATCTTTAGAGGGCTGG + Intronic
1189499432 X:41542090-41542112 ACATACATACTATAAAGGGAAGG + Intronic
1195779103 X:108440591-108440613 ACAGACAAAATTCAAAGAGTGGG - Intronic
1195935339 X:110120106-110120128 ACTGACAAACCTAAAAGGTCTGG - Intronic
1198102234 X:133432274-133432296 ACACACACACTTTAAAGAGCAGG - Intergenic
1199272585 X:145901573-145901595 ACAAACAGATTTTGAAGGGCTGG - Intergenic