ID: 1075705051

View in Genome Browser
Species Human (GRCh38)
Location 10:124495471-124495493
Sequence GCAGGCAGTGGAGGACGCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075705045_1075705051 10 Left 1075705045 10:124495438-124495460 CCAGCTTGTAAGTTTAGCCGGGA No data
Right 1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG No data
1075705040_1075705051 23 Left 1075705040 10:124495425-124495447 CCGTACCTGCAGCCCAGCTTGTA 0: 1
1: 0
2: 0
3: 17
4: 173
Right 1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG No data
1075705043_1075705051 11 Left 1075705043 10:124495437-124495459 CCCAGCTTGTAAGTTTAGCCGGG 0: 1
1: 0
2: 0
3: 1
4: 29
Right 1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG No data
1075705039_1075705051 24 Left 1075705039 10:124495424-124495446 CCCGTACCTGCAGCCCAGCTTGT 0: 1
1: 0
2: 1
3: 20
4: 204
Right 1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG No data
1075705041_1075705051 18 Left 1075705041 10:124495430-124495452 CCTGCAGCCCAGCTTGTAAGTTT 0: 1
1: 0
2: 0
3: 20
4: 329
Right 1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG No data
1075705048_1075705051 -7 Left 1075705048 10:124495455-124495477 CCGGGAAGCATCTGAGGCAGGCA 0: 1
1: 0
2: 2
3: 36
4: 308
Right 1075705051 10:124495471-124495493 GCAGGCAGTGGAGGACGCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075705051 Original CRISPR GCAGGCAGTGGAGGACGCAC AGG Intronic
No off target data available for this crispr