ID: 1075706653

View in Genome Browser
Species Human (GRCh38)
Location 10:124506313-124506335
Sequence ACTGGGTCATTTTGTGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075706642_1075706653 18 Left 1075706642 10:124506272-124506294 CCACCCCGCGGTTTCTCAACCTC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706645_1075706653 13 Left 1075706645 10:124506277-124506299 CCGCGGTTTCTCAACCTCGACAC 0: 1
1: 1
2: 14
3: 116
4: 353
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706643_1075706653 15 Left 1075706643 10:124506275-124506297 CCCCGCGGTTTCTCAACCTCGAC 0: 1
1: 0
2: 0
3: 0
4: 29
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706648_1075706653 -1 Left 1075706648 10:124506291-124506313 CCTCGACACTTGGTGTTTTTGGA No data
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706644_1075706653 14 Left 1075706644 10:124506276-124506298 CCCGCGGTTTCTCAACCTCGACA 0: 1
1: 0
2: 3
3: 8
4: 62
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706640_1075706653 20 Left 1075706640 10:124506270-124506292 CCCCACCCCGCGGTTTCTCAACC No data
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706635_1075706653 25 Left 1075706635 10:124506265-124506287 CCCCCCCCCACCCCGCGGTTTCT 0: 1
1: 1
2: 2
3: 82
4: 615
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706641_1075706653 19 Left 1075706641 10:124506271-124506293 CCCACCCCGCGGTTTCTCAACCT 0: 1
1: 0
2: 0
3: 8
4: 119
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706636_1075706653 24 Left 1075706636 10:124506266-124506288 CCCCCCCCACCCCGCGGTTTCTC 0: 1
1: 1
2: 2
3: 53
4: 512
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706634_1075706653 26 Left 1075706634 10:124506264-124506286 CCCCCCCCCCACCCCGCGGTTTC 0: 1
1: 1
2: 9
3: 121
4: 833
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706637_1075706653 23 Left 1075706637 10:124506267-124506289 CCCCCCCACCCCGCGGTTTCTCA 0: 1
1: 1
2: 1
3: 20
4: 280
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706638_1075706653 22 Left 1075706638 10:124506268-124506290 CCCCCCACCCCGCGGTTTCTCAA No data
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data
1075706639_1075706653 21 Left 1075706639 10:124506269-124506291 CCCCCACCCCGCGGTTTCTCAAC 0: 1
1: 0
2: 1
3: 9
4: 102
Right 1075706653 10:124506313-124506335 ACTGGGTCATTTTGTGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075706653 Original CRISPR ACTGGGTCATTTTGTGGTGA GGG Intronic
No off target data available for this crispr