ID: 1075708710

View in Genome Browser
Species Human (GRCh38)
Location 10:124518739-124518761
Sequence GAGGCCCATTCTCAGTTTAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 85}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075708710_1075708719 13 Left 1075708710 10:124518739-124518761 CCTATAAACTGAGAATGGGCCTC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1075708719 10:124518775-124518797 CCACAGCCCACGAATGCAGGTGG No data
1075708710_1075708725 25 Left 1075708710 10:124518739-124518761 CCTATAAACTGAGAATGGGCCTC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1075708725 10:124518787-124518809 AATGCAGGTGGGCACGAGGGAGG No data
1075708710_1075708720 14 Left 1075708710 10:124518739-124518761 CCTATAAACTGAGAATGGGCCTC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1075708720 10:124518776-124518798 CACAGCCCACGAATGCAGGTGGG No data
1075708710_1075708724 22 Left 1075708710 10:124518739-124518761 CCTATAAACTGAGAATGGGCCTC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1075708724 10:124518784-124518806 ACGAATGCAGGTGGGCACGAGGG No data
1075708710_1075708723 21 Left 1075708710 10:124518739-124518761 CCTATAAACTGAGAATGGGCCTC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1075708723 10:124518783-124518805 CACGAATGCAGGTGGGCACGAGG No data
1075708710_1075708715 10 Left 1075708710 10:124518739-124518761 CCTATAAACTGAGAATGGGCCTC 0: 1
1: 0
2: 1
3: 4
4: 85
Right 1075708715 10:124518772-124518794 CCCCCACAGCCCACGAATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075708710 Original CRISPR GAGGCCCATTCTCAGTTTAT AGG (reversed) Intronic
902570935 1:17346668-17346690 GAGGCCCAGTCTCAGTCCTTGGG - Intronic
907487305 1:54786910-54786932 CAGGCTCCTTCTCAGTTTAGAGG + Intronic
908751275 1:67426134-67426156 GAGGCGAATTTTCAGTTGATAGG - Exonic
910567637 1:88663236-88663258 GAGGACCATTCTGAGTTTTCTGG + Intergenic
915778985 1:158524290-158524312 AAGAAACATTCTCAGTTTATTGG + Intergenic
919229499 1:194755151-194755173 CAGTCATATTCTCAGTTTATGGG + Intergenic
920009102 1:202854915-202854937 GAGGCCCATTATCAGATGATGGG - Intergenic
920672856 1:208017771-208017793 GAGGCCCACTCACATTTTAGAGG - Intergenic
923510184 1:234644435-234644457 GAGTCCCATTCTGAGGTTAGTGG + Intergenic
1064198801 10:13267178-13267200 GAGGCCGAGTCTCACTCTATCGG - Intergenic
1064873521 10:19966759-19966781 GAGGCCTGTTCTCAAATTATGGG - Intronic
1065794750 10:29295848-29295870 GAGGGCCATTCCCAGCTTCTAGG - Intronic
1074191854 10:111145162-111145184 GATGCCCACACTCATTTTATTGG + Intergenic
1074666564 10:115733458-115733480 GAAGTTCATTCTCTGTTTATTGG + Intronic
1075708710 10:124518739-124518761 GAGGCCCATTCTCAGTTTATAGG - Intronic
1077337786 11:2013120-2013142 CAGGCCCATTCTGAGGTTGTGGG - Intergenic
1080102630 11:28476962-28476984 CAACCCCATTCTCAATTTATCGG - Intergenic
1083362220 11:62118337-62118359 GAAAACCATTCTCAGCTTATGGG + Intergenic
1202820770 11_KI270721v1_random:68302-68324 CAGGCCCATTCTGAGGTTGTGGG - Intergenic
1092969134 12:13674669-13674691 GAAGCCCATTCTCAGCCAATTGG + Intronic
1096995664 12:55836627-55836649 AAGGCCCTTGCTCAGTTTACTGG + Exonic
1098608968 12:72431709-72431731 GTGGCCTATTATCTGTTTATTGG + Intronic
1099005852 12:77233901-77233923 GAGGCCAATTCTTAGATAATGGG + Intergenic
1102748850 12:115274401-115274423 GAGGCCCACTCCCAGTATGTAGG - Intergenic
1106077220 13:26471186-26471208 GATGCCGATTCTCAGATTAAAGG - Intergenic
1106851295 13:33795601-33795623 AGGGCTCATTCTCAGTTTCTAGG - Intergenic
1107415689 13:40198232-40198254 GAGAACAGTTCTCAGTTTATAGG - Intergenic
1109960598 13:69623885-69623907 AAGGCCCCTTCCCTGTTTATGGG + Intergenic
1113441220 13:110330146-110330168 AAGGTCCATTCTCAGTTAAAGGG - Intronic
1121692682 14:95889185-95889207 GAGCCACATTCTCACTTTCTTGG + Intergenic
1122486445 14:102085317-102085339 AAGAAACATTCTCAGTTTATTGG - Exonic
1125428052 15:39569418-39569440 GAGGACACTACTCAGTTTATAGG - Intergenic
1127859176 15:62978825-62978847 GAGACCCATTCTCATTCAATGGG - Intergenic
1131589992 15:93738761-93738783 GAGGCCCATTGTCAGTCTGATGG + Intergenic
1133906083 16:10023951-10023973 GAGGCACAATGACAGTTTATGGG - Intronic
1136233757 16:28902623-28902645 GAGGCCCATCCTCAGCGTACAGG - Exonic
1137722351 16:50634838-50634860 GAGGTCCATTCTCGGGTTTTGGG + Exonic
1143174697 17:4949306-4949328 AGGGCCCATTCTCAGTCTAGAGG + Intronic
1143995340 17:11001809-11001831 GAAAACCATTCTCAGTTTGTGGG - Intergenic
1153379907 18:4426816-4426838 GGGACCCAATCTCATTTTATTGG - Intronic
1153928862 18:9860435-9860457 GGAGCCCATTCTCAGTTCCTTGG - Exonic
1163894334 19:20044335-20044357 GAGGTCCATGCTCAGTATCTGGG + Intergenic
928941713 2:36733444-36733466 GAGGACCATGCTCCTTTTATAGG - Intronic
929835383 2:45391981-45392003 GAGGCCCAGTATCCTTTTATGGG - Intronic
931584984 2:63816364-63816386 TAGGCACATTCACAGTTTCTGGG - Intronic
936848461 2:116867322-116867344 CAGGCCTATTCTCAGTGAATAGG + Intergenic
939113546 2:138035125-138035147 GAGGAAAATTCTCATTTTATAGG - Intergenic
939329176 2:140735974-140735996 GGGGCACATTCTCGGTATATGGG + Intronic
940395742 2:153189164-153189186 CAGGCTCATTCTCACTTTCTTGG + Intergenic
943300601 2:186192998-186193020 GAGTCACCTTCTCACTTTATAGG - Intergenic
947820243 2:233064096-233064118 AAGGCCCAATGTCAGTATATAGG + Intronic
1170929843 20:20759081-20759103 GTGGCCCAATCTCAGCTTATTGG + Intergenic
1177302197 21:19262058-19262080 CAGGGCCATTCTCTGTTTAAAGG - Intergenic
1177720627 21:24902445-24902467 GAGGCCCATACTTAGTTTATGGG + Intergenic
1179663343 21:42892578-42892600 GAGCCCCATTCGCATTTCATCGG - Intronic
1182121543 22:27790462-27790484 GAGGCCTGTTCACAGTTTCTCGG + Intronic
1183022485 22:35038511-35038533 AAGGCCCATTTTCAGTATAACGG + Intergenic
949206600 3:1446712-1446734 TAGACCCATTCTCACTTTGTTGG - Intergenic
949957253 3:9279275-9279297 CTGCCCCATTCTCAGCTTATAGG - Intronic
957260425 3:77895364-77895386 TAGGCTCATTCTCATTTTATTGG - Intergenic
957885064 3:86276496-86276518 AAGGCCCAGTGTCAGTATATTGG + Intergenic
966844412 3:184116318-184116340 AAGAAGCATTCTCAGTTTATTGG + Intergenic
967472162 3:189874472-189874494 GAGGCACATTCTCTGTTCAAAGG + Intronic
971613493 4:28757644-28757666 GAGGGCCAGGCTCAGTATATGGG + Intergenic
974274443 4:59699581-59699603 GAGGCAAATTTTCAGTTTGTAGG + Intergenic
977360174 4:95993427-95993449 GTGGCCCATTTTAAGTATATAGG - Intergenic
978143231 4:105341552-105341574 GGGGGTCATTCTCAGTTTCTAGG + Intergenic
979059386 4:116037701-116037723 GAGAACCTTTCTTAGTTTATTGG + Intergenic
980952000 4:139389615-139389637 GAGGCTAGTTCTCAGTGTATAGG - Exonic
989086621 5:37683703-37683725 GAGGTCCACTCTTAGTTTAATGG + Intronic
989981997 5:50656378-50656400 GAGGCGCGATCTCAGTTTACTGG + Intergenic
990073752 5:51817109-51817131 GTGCTCCATTCTCAGATTATAGG + Intergenic
1001658898 5:173375549-173375571 GATGCCCATTCTCAAGTAATAGG - Intergenic
1007243064 6:40440988-40441010 GCGGCCCAGTCTCAGTTAGTTGG - Intronic
1009844278 6:69116181-69116203 GAGGCCCATCCACATTTTAGAGG + Intronic
1011165431 6:84440983-84441005 GAGGCTGTTTCTCAGTTTTTCGG + Intergenic
1011398511 6:86936074-86936096 TAAGCCTATTCTCAGTTTAATGG + Intergenic
1016581548 6:145633887-145633909 GAGGCCCATTCTGAATTTCAAGG - Intronic
1018733698 6:166671934-166671956 AAGGTCCATTCTCAGTTCAGAGG + Intronic
1023832464 7:44047781-44047803 GAGGCTCATTCCCAGTTCAGAGG - Intronic
1036728339 8:11240123-11240145 CAGGCCCATTCTGAGTTACTGGG + Intergenic
1040366405 8:46721733-46721755 GAGACCCATCCTCAATTTAAAGG + Intergenic
1044902325 8:96960123-96960145 GTGGCCCTTTCTTAGTATATTGG + Intronic
1047762482 8:127964331-127964353 GTGGCCCATTCTCAGCTTGGCGG + Intergenic
1048971672 8:139648526-139648548 GTGGCCCATTCTCAGTCCAGAGG - Intronic
1049478659 8:142809652-142809674 GATGCCCATACTGAGTTTCTGGG - Intergenic
1050621466 9:7456422-7456444 GAGGCCCTTTCAGAGTTTGTAGG - Intergenic
1056757606 9:89391686-89391708 GAGGCCCAGCCTCAGTTCTTGGG - Intronic
1059421446 9:114195005-114195027 AAGTCCCTTGCTCAGTTTATGGG - Intronic
1059819016 9:117951090-117951112 GAGGGCCTTTCTGAGTTTATTGG + Intergenic
1061869079 9:133510765-133510787 GAGGCCCTTTCTCAGATTCCAGG + Intergenic