ID: 1075709553

View in Genome Browser
Species Human (GRCh38)
Location 10:124523295-124523317
Sequence GGGGTTTCCCCCCAGTGGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075709544_1075709553 5 Left 1075709544 10:124523267-124523289 CCCTTCTAGCTGTGGCCTGGGTG 0: 1
1: 0
2: 1
3: 28
4: 166
Right 1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG No data
1075709545_1075709553 4 Left 1075709545 10:124523268-124523290 CCTTCTAGCTGTGGCCTGGGTGC 0: 1
1: 0
2: 1
3: 31
4: 208
Right 1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG No data
1075709549_1075709553 -10 Left 1075709549 10:124523282-124523304 CCTGGGTGCTGAAGGGGTTTCCC 0: 1
1: 0
2: 0
3: 14
4: 150
Right 1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG No data
1075709539_1075709553 22 Left 1075709539 10:124523250-124523272 CCGACATCCTGCAAGGTCCCTTC 0: 1
1: 0
2: 2
3: 18
4: 188
Right 1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG No data
1075709538_1075709553 23 Left 1075709538 10:124523249-124523271 CCCGACATCCTGCAAGGTCCCTT 0: 1
1: 0
2: 1
3: 13
4: 174
Right 1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG No data
1075709540_1075709553 15 Left 1075709540 10:124523257-124523279 CCTGCAAGGTCCCTTCTAGCTGT 0: 1
1: 0
2: 0
3: 14
4: 185
Right 1075709553 10:124523295-124523317 GGGGTTTCCCCCCAGTGGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075709553 Original CRISPR GGGGTTTCCCCCCAGTGGGG TGG Intronic
No off target data available for this crispr