ID: 1075711166

View in Genome Browser
Species Human (GRCh38)
Location 10:124531143-124531165
Sequence CAGGGAAGGCCTTGAGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 545
Summary {0: 1, 1: 0, 2: 9, 3: 69, 4: 466}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075711166_1075711178 20 Left 1075711166 10:124531143-124531165 CCATATCCTCAAGGCCTTCCCTG 0: 1
1: 0
2: 9
3: 69
4: 466
Right 1075711178 10:124531186-124531208 TCCCAATTGCAAGGGCCTGAGGG No data
1075711166_1075711174 11 Left 1075711166 10:124531143-124531165 CCATATCCTCAAGGCCTTCCCTG 0: 1
1: 0
2: 9
3: 69
4: 466
Right 1075711174 10:124531177-124531199 CCAGAGTCCTCCCAATTGCAAGG No data
1075711166_1075711175 12 Left 1075711166 10:124531143-124531165 CCATATCCTCAAGGCCTTCCCTG 0: 1
1: 0
2: 9
3: 69
4: 466
Right 1075711175 10:124531178-124531200 CAGAGTCCTCCCAATTGCAAGGG No data
1075711166_1075711177 19 Left 1075711166 10:124531143-124531165 CCATATCCTCAAGGCCTTCCCTG 0: 1
1: 0
2: 9
3: 69
4: 466
Right 1075711177 10:124531185-124531207 CTCCCAATTGCAAGGGCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075711166 Original CRISPR CAGGGAAGGCCTTGAGGATA TGG (reversed) Intronic
900238133 1:1602017-1602039 CAGCAAAGGCCTCGAGGCTAAGG - Intergenic
902241281 1:15090975-15090997 GAGGGAAGGCCTTGTGGGGAGGG + Intronic
902736025 1:18401478-18401500 TAGGGAAGTCCTGGAGGATTGGG + Intergenic
902745986 1:18474768-18474790 CAGGTAAGGCCTTGAGTGGAGGG - Intergenic
903179721 1:21599043-21599065 CAGGGAAGGCTTTCAGGAGGAGG + Intronic
903180309 1:21601910-21601932 CAGGGCTGGCCCTGAGTATAGGG - Intronic
903266375 1:22160440-22160462 CAGGGAAGGCCTCGTGGAGGAGG - Intergenic
903628866 1:24750913-24750935 CAGTAAATTCCTTGAGGATAGGG + Intronic
904412887 1:30335719-30335741 CTGGGGAGGCCTTGAGGGTTTGG - Intergenic
904482839 1:30805008-30805030 CAGGGAAGGCTTTCAGGAGGAGG + Intergenic
904551771 1:31324887-31324909 CAGGGATGGCCTAAAGCATAGGG + Intronic
904577438 1:31514153-31514175 CAGGGAAGGCCTGAAGGCTGCGG - Intergenic
904621937 1:31781108-31781130 CAGGGAAGGCCCAGAAGATCAGG - Intergenic
904936081 1:34130712-34130734 CAGGGAAGGCATTGAGCGCAGGG - Intronic
905483631 1:38279858-38279880 CAGGGAAGGCCTCCATGACAGGG - Intergenic
905493662 1:38365586-38365608 TTGTGAATGCCTTGAGGATAAGG - Intergenic
906729777 1:48071097-48071119 CAGGCAAGACCTTGTGGGTATGG - Intergenic
906926878 1:50127284-50127306 CAGGGAATGCCTTGAAAATAAGG - Intronic
907052242 1:51337388-51337410 CAGGGAAGGCCTCACGGAGAAGG - Intronic
907282480 1:53360139-53360161 CAGTGAGGGCCATGAGGGTAGGG + Intergenic
907908328 1:58805382-58805404 CAGGGAAGGCCTTTCTGATATGG - Intergenic
908677845 1:66625862-66625884 CAAGGAAGGCCTTTGGAATACGG + Exonic
908816450 1:68040220-68040242 TAGGGAAGGCCATGAAGAGAGGG + Intergenic
908927386 1:69272291-69272313 CAGGAAAGGCTTTGTGGAGAAGG + Intergenic
908992918 1:70115402-70115424 CGGGGAAGGCCATGAAGAGAGGG - Intronic
909109683 1:71458946-71458968 CAGGGAAGGTTTTGAGGAATGGG - Intronic
910687174 1:89929243-89929265 CAGGGAAGGCTTTCTGGAAAAGG + Intronic
912452244 1:109774261-109774283 CAGGGAAGGTCCTGAGGGCAAGG + Intronic
912486997 1:110036613-110036635 CAGTGAATGCCTGGAGGACAGGG + Intronic
912516269 1:110218419-110218441 CAGGTAAGGCCTTAATGACAAGG - Intronic
912565794 1:110586337-110586359 CAGGGAAGGTCTCTTGGATAAGG - Intergenic
914398183 1:147290617-147290639 CAGGGAAGGCCATGAAGGGAAGG - Intronic
914750735 1:150533266-150533288 GAGGGACGGCCTTGAGGGGATGG + Intergenic
914778757 1:150763973-150763995 TAGGGAAGGCCTCACGGATAAGG - Intronic
916863385 1:168830974-168830996 CAGGGAAGGCTTTTAGGAGCAGG + Intergenic
917253380 1:173087583-173087605 CAGGGAAGGCTTCAAGGGTAAGG - Intergenic
917467036 1:175288808-175288830 CAGGGAAGGCCATGAAGAGAAGG + Intergenic
918954680 1:191190536-191190558 ATGGGAAGGCATTGAGGACAAGG - Intergenic
919239197 1:194889602-194889624 CAGGGAGGGCCTGGAGGCTGAGG + Intergenic
919255964 1:195125602-195125624 TAGGAAATGCATTGAGGATATGG - Intergenic
919777769 1:201205389-201205411 CAGGGAAGACCTTGGGGCTGCGG + Intronic
920198220 1:204243443-204243465 CAAGGAAGGCCTTGAAGGTCAGG - Intronic
920253900 1:204641043-204641065 CAGGGAAGGCCATGAAGAGAGGG + Intronic
920275327 1:204800208-204800230 TAGAGAAGGCATTGAGGAAAAGG + Intergenic
920612919 1:207459275-207459297 CAGGGAAGGCCATGAAAATAGGG - Intronic
920840396 1:209549141-209549163 CAGGGAAGGCTTTGGGGAAGAGG + Intergenic
920882898 1:209896979-209897001 CAGGGAAGGCTTTGGGGAGAAGG + Intergenic
921029660 1:211326526-211326548 CAAGCAAGGCCTTGAGCAAATGG + Intergenic
921117621 1:212108920-212108942 CACGGAAAGCCTGCAGGATAAGG + Intergenic
921460717 1:215423338-215423360 CAGGGAAGGCCGTGGAGAGAAGG + Intergenic
921734578 1:218612390-218612412 CCAGGAAGGCATTGAGCATAGGG + Intergenic
922430770 1:225550228-225550250 CAGGGAAAGCTTTGAAGAGAAGG - Intronic
923131278 1:231076908-231076930 GAGGGAAGACCATGAGGATACGG + Intergenic
923613091 1:235512547-235512569 CAGGGAAGGCCTCATGGAAAAGG - Intergenic
923974734 1:239249436-239249458 CAGTGAACTCCTTGAGGACAAGG - Intergenic
1063437794 10:6048631-6048653 CATGGAAGTCCATGAGGGTAGGG - Intronic
1063475067 10:6321103-6321125 GAGGGAAGGCTTTGAGAAGATGG - Intergenic
1064142092 10:12799096-12799118 CAGGGAAACCCTGGAGGACACGG + Intronic
1065101224 10:22334998-22335020 CTGGAAAGGCCTAGAGGAGAGGG + Intergenic
1065288777 10:24209765-24209787 CAGGGGAGGGCTTGAGCATCTGG + Intronic
1066357431 10:34698428-34698450 CAGGGCTGGCCTGGAGGGTAAGG - Intronic
1067414118 10:46091120-46091142 CAGGGAAGGCTTCCAGGATGAGG + Intergenic
1067439524 10:46300695-46300717 CAGGGAAGGCTTCCAGGATGAGG - Intronic
1067527474 10:47047223-47047245 CAGGGAAGCCCTGGAGGTTGTGG + Intergenic
1067576249 10:47410244-47410266 CAGGGAAGGCTTCCAGGACAAGG - Intergenic
1068584254 10:58778716-58778738 TAGGGAAGGCCTAGAGCAGATGG + Intronic
1069739975 10:70681260-70681282 CAGGGAAGGCTTCCAGGGTAGGG + Intronic
1069936764 10:71922786-71922808 CAGAGAAGGCCATGAAGAGATGG + Intergenic
1070777173 10:79116454-79116476 CAGGGAGGGCCTCCAGGAGAAGG + Intronic
1070779829 10:79131067-79131089 CATGGAATGCCTTCAGGCTATGG + Intronic
1070923566 10:80204272-80204294 CAAAGAATGCCTTGAGGAAAGGG + Intronic
1071941721 10:90598241-90598263 GAGGGAGGGCCTTGAGAATCTGG - Intergenic
1073179366 10:101574582-101574604 CAGGCAAGGCCTTGGGTAGAAGG - Intronic
1074710997 10:116177432-116177454 CAGGGCAGGCCTTGGGGTTAGGG + Intronic
1074875513 10:117610367-117610389 CTGGGAAGGCCCTGGGGAGAAGG - Intergenic
1075018195 10:118926650-118926672 CCGGGAAGGCGGTGAGGATGTGG + Intergenic
1075640944 10:124064378-124064400 TGGGGAAGGCCTTGGGGATGGGG - Intronic
1075700476 10:124466361-124466383 CTGGGAAGAGCTGGAGGATAAGG + Intronic
1075711166 10:124531143-124531165 CAGGGAAGGCCTTGAGGATATGG - Intronic
1075727588 10:124618389-124618411 CAGGGATGGCAGTGAGGACAAGG + Exonic
1075742680 10:124705441-124705463 CAGGGAAAGCCTTGCGGAGCAGG - Intronic
1076559373 10:131351158-131351180 CAGGGAAGCCCTAGTGGGTAGGG + Intergenic
1076655157 10:132019143-132019165 CAGGGAGGGCCTGAAGGCTAGGG - Intergenic
1077106798 11:845738-845760 CAGGGAAGGCCTGGAGTGTGGGG + Intronic
1077296182 11:1827245-1827267 CAGGGAAGGCTTTGAGCACACGG + Intergenic
1077395773 11:2320438-2320460 CAGTGAAGTCCTATAGGATATGG - Intergenic
1077449814 11:2633450-2633472 AAGGGAAACCCTTCAGGATATGG - Intronic
1078350827 11:10591768-10591790 CAGGGAAGGCCTGAGGGAAAGGG - Intronic
1079164443 11:18026006-18026028 CAGGGAAGGCCTTGCTGAGAAGG - Intronic
1079583483 11:22095691-22095713 CAGGGAAGGCTTTGAAGAAAGGG - Intergenic
1080379800 11:31756521-31756543 AAGGAAAGGCTTTGAGGAGAAGG - Intronic
1081335520 11:41861199-41861221 CAGGGAACGCCATGAAGAGAAGG + Intergenic
1081440987 11:43080793-43080815 CAGGGAAGGCTATGAAGAGAGGG - Intergenic
1081599076 11:44479871-44479893 AAGAGAATGCCTTGAGGATTAGG - Intergenic
1082821386 11:57546557-57546579 CAGGGAAGAACTTGTGGATGAGG - Exonic
1083680646 11:64350202-64350224 CAGGGAAGGTTTTGTGGAGAAGG + Intronic
1084113999 11:67031311-67031333 CAGGGAAGGACTCCAGGACAGGG - Intronic
1084312028 11:68322598-68322620 CTGGGAGGGCCTTGAGGACAGGG + Intronic
1085287675 11:75374764-75374786 TAGGGAAGGCCTAGTGGAGAAGG + Intergenic
1085440339 11:76556301-76556323 CAGGGAAGGCCTTACTGAAAAGG + Intergenic
1085735856 11:79038465-79038487 CAAGGAAGGCATTGGGGAAAAGG - Intronic
1087036254 11:93758869-93758891 CAGGGAAGGCCTGAAGGCTGGGG + Intronic
1087117533 11:94541648-94541670 CATGGAAGGCTTTGAGGAGGTGG - Intergenic
1087505080 11:99010499-99010521 AAGGGATGGCTTTTAGGATAAGG - Intergenic
1087708556 11:101522517-101522539 CAGGGAAGGCCTTAGTGAGAAGG - Intronic
1088528136 11:110778701-110778723 CAGGGAAGGCCTTCACAAAATGG + Intergenic
1089274678 11:117326607-117326629 CAGGGAAGACCATGAAGAGAGGG - Intronic
1089544554 11:119213170-119213192 CAGGGAAGGCAAGGTGGATAGGG - Intronic
1089658238 11:119967975-119967997 CAGGGCAGGCCTTGCTGAGATGG + Intergenic
1089767435 11:120778022-120778044 CAGGGAAGGCCTTGCCGCTCAGG + Intronic
1090765952 11:129876602-129876624 CAGGGTAGGCTTTGAGAACAAGG - Intronic
1090944048 11:131413892-131413914 CAGGGGAGACCATGAGGACAAGG + Intronic
1091760673 12:3085229-3085251 GAGGGAAGGACTTAAGGACAAGG + Intronic
1092598342 12:10031848-10031870 CAGTGAAGGCTCTGAGGATTGGG + Intronic
1092619132 12:10244281-10244303 CAGGGAACACCTTCAGGACAGGG + Intergenic
1092995271 12:13943727-13943749 CAGGAAAGGCCTTTTGGATAAGG - Intronic
1093093878 12:14950803-14950825 CAGAGAAGTCCATGAGGGTAAGG - Intronic
1093717095 12:22395308-22395330 CAGGCTGAGCCTTGAGGATAAGG - Intronic
1095597089 12:43971526-43971548 CAGTGAAGGCGTGGAGGGTAGGG - Intronic
1096024182 12:48347043-48347065 AAGGGAATTCCTTGAGGTTAGGG - Intronic
1096238046 12:49943114-49943136 CAGGGCAGGCTTTAAGGACAGGG + Intergenic
1096375956 12:51110857-51110879 CAGGTAAGGCGTTGCAGATAGGG - Exonic
1096462058 12:51827249-51827271 GAGGAAAGGCCCTGAGGACATGG + Intergenic
1099346086 12:81501328-81501350 CAGAGAATGCCTTGATGAGAAGG - Intronic
1099794732 12:87385133-87385155 CAGGAAAGGCCATGAAGAGAGGG - Intergenic
1100594090 12:96056476-96056498 CAGGGAAAGCCAGGAGGATTGGG - Intergenic
1101652935 12:106694256-106694278 GATGGAAGGCTTGGAGGATAAGG - Intronic
1101714911 12:107302223-107302245 CAGGGAAGTCCCTGGGGAGAAGG - Intergenic
1102234069 12:111283260-111283282 CAGGTTAGGCCTTCAGGATGTGG + Intronic
1102728556 12:115087923-115087945 CAGAGAAGGCCATGTGCATAAGG + Intergenic
1103219169 12:119229215-119229237 CAGAGAAGGCCTGGATGAGAAGG + Intergenic
1103434970 12:120918063-120918085 CCTGTAAGGCCTTGAAGATAAGG + Intergenic
1103586870 12:121962748-121962770 CAGGGAAGGCCTTGGAGAGCAGG + Intronic
1103731614 12:123031645-123031667 CTGGGCAGGCCTTGAGGCTGGGG - Intronic
1104011851 12:124936426-124936448 CAGGGAAGGCCATGAAGAGAGGG - Intergenic
1104509984 12:129368484-129368506 GAGTGAATGCTTTGAGGATAGGG + Intronic
1104601160 12:130154389-130154411 CAGGGAAGGCCTGGATGAGAAGG - Intergenic
1105970259 13:25422976-25422998 CAAGGAAGGCCATGAAGAGAGGG - Intronic
1107137265 13:36958126-36958148 AAGGGAAGGCCATGGGGATTGGG - Intronic
1107147047 13:37070342-37070364 CAGGGAAGGCCTGAAGGCTTGGG + Intergenic
1107717810 13:43217764-43217786 CAGGGAATGCCCTGAGGACTTGG + Intronic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1108685130 13:52812960-52812982 AGGGGAAGGCCTTGGGAATAAGG + Intergenic
1110301841 13:73937693-73937715 CAGGGCAGGCCCTGAGGGAAAGG + Intronic
1110512247 13:76364593-76364615 CAGGAAAGGCCATGAAGAGAGGG - Intergenic
1110633416 13:77736715-77736737 CAGGGAGGGCATGTAGGATAAGG - Intronic
1111485699 13:88895873-88895895 CAGGGATGGTCTTGAGCATGGGG + Intergenic
1111546668 13:89746957-89746979 CAGGGAAGCCCATGAAGAGATGG - Intergenic
1112596246 13:100809915-100809937 CAGGCAAGGCCATGAAGAAAGGG - Intergenic
1112753367 13:102604278-102604300 CAAGGAAGGCCTTGCTGAGATGG - Intronic
1113473555 13:110563475-110563497 CGGGGAAGGCCATGAAGAGAGGG - Intergenic
1114646919 14:24261047-24261069 CAGGGTTGGCCTTCAGGATCAGG - Intronic
1115484996 14:33901767-33901789 CAGGGAAGGCCTATAGCCTAGGG + Intergenic
1118206922 14:63730895-63730917 CATGGAAGGCTTTTAGGCTAGGG + Intergenic
1118649460 14:67874579-67874601 CAGGGACTGCCTTGGGGAGAGGG + Intronic
1118681351 14:68245097-68245119 CAGGGTAGGTCTGGAGGAGATGG - Intronic
1119263651 14:73252219-73252241 GAGGGACTGCCTTGAGGAGAGGG - Intronic
1119683177 14:76608266-76608288 AAGGCAAGGCCTTGATGAGATGG - Intergenic
1120692031 14:87603406-87603428 CAGGGAAGACCCTGAAGAGAGGG + Intergenic
1122282643 14:100633131-100633153 CAGGGAAGGCCATGAGCCTCTGG - Intergenic
1122367302 14:101201738-101201760 CCGGGACGGCATTGAGGATGGGG - Intergenic
1122474066 14:101993671-101993693 CAGGAAAGGCCTTGCTGAGAAGG - Intronic
1122556009 14:102580470-102580492 CAGGGATGGCCTTGCTGAGAAGG + Intergenic
1122602730 14:102929564-102929586 CTGGGAAGGCCTGGAGGACCAGG + Intronic
1202844353 14_GL000009v2_random:153788-153810 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1202913747 14_GL000194v1_random:144027-144049 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1202878912 14_KI270722v1_random:38682-38704 CAGAAAAGGCCTTGAAGAGAGGG - Intergenic
1123878685 15:24652862-24652884 CAAGGAAGGCCTCCAGGAAAAGG + Intergenic
1123890707 15:24775680-24775702 CAAGGAAGGCCTCTAGGATGAGG + Intergenic
1126736055 15:51733208-51733230 CAGGGAAGACCTTGCTGAGAAGG - Intronic
1127707584 15:61562442-61562464 AATGGAAGGCCTTGAGGGTTGGG + Intergenic
1127854144 15:62941112-62941134 CAGGGCAGGCCTTGATGGCAGGG - Intergenic
1129253652 15:74321976-74321998 TAGGGAAGGCTTTGAAGATAGGG + Intronic
1129369049 15:75076600-75076622 CAGGGAAGGCCTGAAGGCTGGGG - Intronic
1129448767 15:75637573-75637595 CTGGGAAGGCATTAAGGAAAAGG - Intergenic
1130021327 15:80234201-80234223 GGGGGAAGGCTTTGGGGATACGG + Intergenic
1133204651 16:4226088-4226110 CAGGGAAGGCCTTATGGAGCTGG - Intronic
1134075750 16:11290290-11290312 CAGGGCAGGCCTTGTTGAGAAGG + Intronic
1134289943 16:12896325-12896347 CAGAGAAGGCCTTATGGGTATGG - Intergenic
1134363457 16:13554341-13554363 CAGGGAAGGGCATGGGGATAAGG + Intergenic
1134389592 16:13807192-13807214 CAGGGAAAGCTTTGGGGATGAGG - Intergenic
1135152025 16:20016506-20016528 CAGGGAAGGCTATGAAGAGAGGG - Intergenic
1135992330 16:27225642-27225664 CAGGGAAGCCCTTGGAGACAGGG - Intronic
1136092464 16:27930180-27930202 AAGTGAAGGCGTTGAGGTTATGG - Intronic
1136736762 16:32473933-32473955 CACGGAAGGGCTTGGGGATCAGG + Intergenic
1137318964 16:47358989-47359011 CAGGGAAGGCCTCCAGGAGAGGG + Intronic
1137826351 16:51499324-51499346 CAGGGAAAACTTTGAGGAAATGG - Intergenic
1138088471 16:54155082-54155104 CAGTGAGGGCCCTGAGGATATGG + Intergenic
1138483357 16:57318724-57318746 CAGGGAAGGACGTGAGGAAGTGG - Intergenic
1139112187 16:63904843-63904865 TAGGGAAGGCCTGGAGCCTAGGG + Intergenic
1139421768 16:66853531-66853553 CATGGAAGCCCTTGAGAAGATGG - Exonic
1203016306 16_KI270728v1_random:355644-355666 CACGGAAGGGCTTGGGGATCAGG - Intergenic
1203034641 16_KI270728v1_random:628802-628824 CACGGAAGGGCTTGGGGATCAGG - Intergenic
1142551948 17:746284-746306 CAGGGAAGGCAGTGAGAATCTGG + Exonic
1143093975 17:4466951-4466973 CAGGGGAGGCCTTGTTGAGACGG + Intronic
1144827747 17:18115854-18115876 CAGGGAAGGCCTAGTGGCTATGG - Intronic
1148472233 17:47902069-47902091 CAGGGAAGGTCTCAATGATAAGG + Intronic
1149630341 17:58116687-58116709 CAGAGAAGGCCTGGAGGGAAGGG + Intergenic
1150524926 17:65912486-65912508 ATGGGAGGGCCTAGAGGATATGG - Intronic
1150731630 17:67700074-67700096 CAGGGAAGCACTTGAAGATTTGG - Intergenic
1151260674 17:72913537-72913559 AAGGAAAGGCCTAAAGGATAAGG + Intronic
1151388226 17:73768364-73768386 CAGGGCTGGCCTTGGGGACATGG + Intergenic
1151678173 17:75610509-75610531 CAGGGGAGGCCTGGAGGGGATGG - Intergenic
1152112208 17:78363206-78363228 CTGGGGAGGCTTTGAGGAGAGGG + Intergenic
1152465466 17:80463919-80463941 CAGGCCAGGCCTTGAGCATCTGG + Intergenic
1153476857 18:5506485-5506507 CAGGGAAGGCCTCGCTGAGAAGG - Intronic
1153892088 18:9526682-9526704 CCTGGAAGGCCTTGAAGATCAGG + Intronic
1155150338 18:23117948-23117970 CTGGGAATTCCTTGAGGACAAGG - Intergenic
1155347729 18:24875338-24875360 CAGGAAAGGGCATGGGGATAAGG + Intergenic
1155364375 18:25035663-25035685 CTGGGAAGGCCCTGATAATAGGG + Intergenic
1156220368 18:35044744-35044766 GAGGGAACACCTAGAGGATAGGG + Intronic
1156302910 18:35850870-35850892 CAGGGAAAGCCATGAAGAGAGGG - Intergenic
1156358073 18:36360157-36360179 TAGGCAAGCCCTGGAGGATATGG + Intronic
1156385291 18:36599104-36599126 CAGGGAAGACCTTAAGGAAAGGG - Intronic
1156483338 18:37449687-37449709 CAGGGAAGGCCTCTCTGATAAGG + Intronic
1157455437 18:47824249-47824271 CAGGGAAGTCCATGAAGAGAGGG + Exonic
1158132440 18:54167694-54167716 CAAGGAAGGCCTTTGGTATATGG + Intronic
1158419668 18:57281781-57281803 TGAGGAAGGCCTTGAGGAGATGG + Intergenic
1160040554 18:75341353-75341375 CAGGGCTGGCCTTGAGCATCTGG - Intergenic
1160417363 18:78720744-78720766 CGGGGAACGCCATGAGGAGATGG - Intergenic
1160547390 18:79668838-79668860 CAGGGAAGGCCTTGAAGAGAGGG + Intergenic
1160939457 19:1613589-1613611 CAGAGGAGGCCTTGAAGACACGG + Intronic
1160970844 19:1767145-1767167 CAAGGAAGGCCTTGAGCCTCAGG - Intronic
1161486684 19:4539674-4539696 CAGGGAAGCCCTGGAGGAGGAGG - Intronic
1161780172 19:6286477-6286499 CAGGGAGGGCCTGAAGGCTAGGG + Intergenic
1161973518 19:7596489-7596511 AAGGGAAGGCCTTGGGGGTGCGG - Intronic
1162065188 19:8121195-8121217 CAGGGAGGGCATTGAGGAGAGGG - Intronic
1162554796 19:11380139-11380161 CAGGGAAGGCCTCCAGGAGGAGG - Intronic
1163438196 19:17308017-17308039 CAGGGAAGTCTTGGAGGAAATGG + Intronic
1163530739 19:17847601-17847623 CCGGGAAGGCCTGGAGGGTAGGG + Intronic
1163609656 19:18294329-18294351 CAGGGGAGGCTTTGGGGATGTGG + Intergenic
1163630438 19:18415559-18415581 CAGGGAAGGCTTGGAGGAGGAGG + Intergenic
1165121086 19:33558911-33558933 CAGGGAGGGCGTTTGGGATAGGG + Intergenic
1165390737 19:35537274-35537296 CAGGGAAGGCCTTGGGGAGAAGG + Intronic
1166384776 19:42374866-42374888 CAGGGAAGGCCTAGGTGAGAAGG + Intronic
1166799202 19:45445562-45445584 CAGGGAAGGCCTAAATGAGAAGG + Intronic
1167426477 19:49432339-49432361 CAGGGCAGGCCTGGATGAAAGGG - Intronic
1167672268 19:50860045-50860067 CAGGGAAGGCCTTTCGGGCAGGG - Exonic
1167695256 19:51011521-51011543 CAGGGAAGTCCTTGAGATCAGGG + Intergenic
1167960204 19:53098991-53099013 CAGGGAAGACCAAAAGGATAGGG - Intronic
1168172349 19:54597001-54597023 CAGGGAAGGCTGGGAGGAGATGG + Intronic
1168470865 19:56639497-56639519 CAGGGAAGGCCTTTTAGAAAAGG - Intergenic
1168647030 19:58066082-58066104 CTGGGAACCCCTTGAGGGTAGGG - Intronic
1168669607 19:58230590-58230612 CAGGGAAGGCCAGGAGCATCAGG + Intronic
1202654531 1_KI270708v1_random:7695-7717 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
925174733 2:1774624-1774646 CAGGCAAGGCCATGAGGAGAGGG - Intergenic
925292389 2:2756384-2756406 CAGGGAAGGGGTTGGGGAGACGG - Intergenic
927089072 2:19696707-19696729 CAGGGAAGGCTTTGAGGTATTGG + Intergenic
927233342 2:20846955-20846977 GAGGTAGGGCCTTGTGGATATGG + Intergenic
927555042 2:24025224-24025246 CAGGGAAGGCCAGGCGGATGGGG + Intronic
927681704 2:25143913-25143935 CAGGTAAGGGCCTGAGCATAAGG + Intronic
927811212 2:26181260-26181282 CAGGGAAGGACTTAGGGAGAGGG - Intronic
928205060 2:29278134-29278156 CAGGGAAGGGCTTGAGGATGTGG + Intronic
928213404 2:29340800-29340822 CAGGGAAGGCCTTGCTGAGAAGG - Intronic
928223436 2:29424965-29424987 CAGTGAATGCCTTTAGAATAGGG - Intronic
928371286 2:30741945-30741967 CAGGGAAGCCCTTCAGAACATGG - Exonic
928662098 2:33513029-33513051 CAGGAAAGGCCTTACAGATAAGG + Intronic
929141810 2:38673100-38673122 CAGGAAAGGCCTGGAAGAGAAGG + Intronic
930284324 2:49409325-49409347 CAGGGAAGGCTGTGAAGAGAGGG + Intergenic
931057005 2:58483500-58483522 CAGTGAGGGCCTGGAGGATAGGG - Intergenic
931473322 2:62562505-62562527 GAGGAAAGGCCTGGGGGATAAGG - Intergenic
931621254 2:64211847-64211869 CAGGGGAGGCCTTGCTGAGAAGG - Intergenic
931685682 2:64790123-64790145 CAGGGAAGGTATTGGGGGTAGGG - Intergenic
932212785 2:69945976-69945998 CTGGGAGGGCCTTAGGGATAGGG + Intergenic
932784510 2:74588119-74588141 CAGGTCAGGCCTAGAGGTTAGGG - Intronic
934026121 2:88003034-88003056 CAGGGAAGGCCCAGAGGAGAGGG - Intergenic
935588240 2:104821170-104821192 CAGGGACTGCCTGGGGGATAAGG - Intergenic
937182328 2:120007941-120007963 CAGTGATGGCCATGATGATATGG - Intergenic
937237206 2:120438019-120438041 CTGGACAGGCCTTGAGGACATGG + Intergenic
937485389 2:122309990-122310012 CAGGGAAGGCCATGAAGAGAAGG - Intergenic
938200922 2:129372712-129372734 CAGGGTAGGCCTTGCAGGTATGG - Intergenic
939165685 2:138639044-138639066 CAGGGAAGGCCTCTCGGAGATGG - Intergenic
939174549 2:138734503-138734525 CAGGGAAAGCTTTAAGGAGAAGG + Intronic
940046829 2:149418669-149418691 CAGAGAAGGCCTAGAGCATTTGG + Intronic
940247694 2:151637232-151637254 CAGGGAAGTTCTTGAAGATGGGG + Intronic
944343899 2:198637254-198637276 CAGGGAAGACCTCAAGGAGAAGG - Intergenic
945022505 2:205587948-205587970 CAGGGAAGGCCTTAAGGGCAGGG + Intronic
945204444 2:207317058-207317080 CAAGGAAGGCCATGAAGAGAGGG - Intergenic
945375308 2:209073004-209073026 CAAGGAAGACATTGAGAATATGG - Intergenic
946829887 2:223717816-223717838 CAGGGAAGGCCATGAAGGGAGGG - Intergenic
947651805 2:231792847-231792869 CAGCGAAGGCCCTGAGTATCAGG - Intronic
947943048 2:234075646-234075668 GAGGGAAGGCCATGAGCAGAAGG - Intronic
947999987 2:234559898-234559920 CAGGGAAGGCTTTATGGATCAGG + Intergenic
948084461 2:235235672-235235694 CAGGCAAGGCCGTGAAGAGAGGG + Intergenic
1168762289 20:357387-357409 CAGGGAAGGCCTTGCTGAGAAGG - Intronic
1170097398 20:12661999-12662021 CAGGGAAGGCCAAGGGGCTATGG - Intergenic
1170482178 20:16776815-16776837 CAGGGAAGGCCTCAATGAGAAGG - Intergenic
1170541832 20:17396881-17396903 CAGTGAAGGCCTCTAGGAAATGG + Intronic
1170707901 20:18761994-18762016 GAGGGTAGCCCTTGGGGATATGG + Intronic
1171179427 20:23081607-23081629 CAGGGAAGGTTTTGAGGAACTGG + Exonic
1171354806 20:24535813-24535835 CAGGGGAGGCCATGAAGAGAGGG - Intronic
1171395899 20:24832860-24832882 CAAGGATGGCCTTGAAAATAGGG + Intergenic
1171933579 20:31251543-31251565 CAGGGAAGGTCATGAAGAGAGGG - Intergenic
1172786380 20:37471578-37471600 CAGGGAAGGCCTCTTGGAAAAGG - Intergenic
1172903244 20:38350058-38350080 CAGGGAAGGCTTCCAGGAGAAGG + Intronic
1173639558 20:44591209-44591231 CAGCGAAGGCCTGGAGGCTTGGG + Intronic
1173786775 20:45799570-45799592 CAGGGAAGGCCTTGCTCAGAAGG - Intronic
1174110233 20:48193673-48193695 CAGGGAAGGCCTAGTGGAGATGG - Intergenic
1174188118 20:48721383-48721405 CAGGGAAGGCCTTGGGCAGGAGG + Intronic
1175121315 20:56718265-56718287 CAGGGAAGGGCTTGATGAGTGGG - Intergenic
1175140052 20:56854247-56854269 CAGGGAAGGCCCAGAGGACAAGG - Intergenic
1175219188 20:57407299-57407321 CTGGGAAGGCCTTGCTGAGAAGG + Intronic
1175392647 20:58636812-58636834 CAGGGAAGGCTTTCAGGAGGAGG - Intergenic
1176242378 20:64081066-64081088 CAGGGAAGGCCTGGGTGAGAGGG + Intronic
1176633103 21:9158712-9158734 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1176640216 21:9296117-9296139 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
1177858295 21:26424094-26424116 GAGGGAAGGCCTTGATGTGAAGG + Intergenic
1178472109 21:32903045-32903067 CAGGGAAAGCCATGAAGAGAGGG + Intergenic
1178673583 21:34613167-34613189 CAGGGAAGGTCTTACTGATATGG - Intronic
1178703165 21:34851287-34851309 CAGGGAAGGCCTGGAGGCCTCGG + Intronic
1179469343 21:41600229-41600251 CACAGAAGGCCTTGAGCACAGGG + Intergenic
1180349236 22:11785501-11785523 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
1180373524 22:12068955-12068977 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
1180388966 22:12206711-12206733 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1180424259 22:12903580-12903602 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
1180705613 22:17808183-17808205 CAGGGAAGCCCTGGAGAATGTGG - Intronic
1181140090 22:20797951-20797973 CTAGGAATGCCTTGAGGACAGGG - Intronic
1182022060 22:27089733-27089755 TAGAGAAGGCCTTGAGGAAGTGG + Intergenic
1182661992 22:31931716-31931738 CAGGGAAGGCCTGGAGGAGATGG + Intergenic
1182788724 22:32930639-32930661 CAGGAAAAGCTTTGAGGAAAAGG - Intronic
1183042263 22:35191139-35191161 CAGGGAAGGCCTTGCTGATGAGG - Intergenic
1183208546 22:36435615-36435637 CAGGGAAGGCCGTGAAGGGAGGG - Intergenic
1183743094 22:39679076-39679098 CAGGGAGGGCGGTGAGGATGAGG - Intronic
1184076149 22:42179748-42179770 CAGGGAAGGCCTGGAGGAGAGGG - Intronic
1184352273 22:43952158-43952180 CAGGGAAGGCCTGGAGGCACAGG - Intronic
1184520046 22:44988029-44988051 CAGGGAATCCCTGGAGGATTTGG + Intronic
1184865832 22:47201553-47201575 CAGGGAAGGCCTGAAGGCTGGGG - Intergenic
949637061 3:5994718-5994740 AAGGGCAGGACTTGAGGCTAGGG - Intergenic
950202902 3:11057431-11057453 CAGGGAACCCCTTGAGGATAAGG + Intergenic
951136238 3:19107351-19107373 CAGGGAAGGCCTGAAGGTTGGGG - Intergenic
951718475 3:25673894-25673916 CAGGGAAGGCCTGGAGCCTGGGG - Intergenic
952591244 3:34956769-34956791 CAGGGAAGGCCATGAAGAGAAGG - Intergenic
954105159 3:48405871-48405893 CAGGGAAGGGCTGGGGGAGAAGG + Intronic
954462683 3:50636723-50636745 GAGGGGAGGCCTGGAGGAGAAGG + Intronic
954495891 3:50961435-50961457 TAGGGAAGTCCTTCATGATATGG + Intronic
954880575 3:53833377-53833399 AAGGGAACTCCTTGAGGACAGGG + Intronic
956093933 3:65696213-65696235 CAGGGAAGGCCTCCTTGATAAGG - Intronic
956636750 3:71372356-71372378 CAGGGAAGGCCTCTTGGAAAAGG - Intronic
957099967 3:75814641-75814663 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
958666435 3:97144095-97144117 CAGGGAAGGCCATGAAATTAAGG - Intronic
960574803 3:119218912-119218934 CAGGGAAGGCCAGGAGCATTGGG - Intronic
961147968 3:124611144-124611166 CAGGGAAGGCTGTGCTGATAAGG + Intronic
961296300 3:125887207-125887229 CAGGGGAGTCCTTGAGCAGAAGG - Intergenic
961524681 3:127489237-127489259 CAGGGAAGGCCTTTCGGACATGG + Intergenic
961561320 3:127732395-127732417 CAGGGAGGGACTTGAGTACAGGG + Intronic
961993074 3:131213093-131213115 CAAGGTAGGCCATGAGGGTAGGG - Intronic
963207887 3:142655223-142655245 ATGGGAAGGCGTTAAGGATATGG + Intronic
963634294 3:147775108-147775130 CAAGGAAGTCCTTGATGAAAAGG - Intergenic
963659353 3:148104436-148104458 CAGGGAAGGCTTTGAGGCAGAGG + Intergenic
963757452 3:149250576-149250598 CAGGGTAGGCCTCGATGAGAGGG + Intergenic
963954283 3:151235833-151235855 CAGGAAAGGCCTTGCTGAGAAGG - Intronic
964896480 3:161602724-161602746 CAGGGAAGGCCATGAAGGGAGGG - Intergenic
966417779 3:179707260-179707282 CAGGGAAGGGCTTAGGGGTATGG - Intronic
966903961 3:184508410-184508432 CAGGGAGGACCTTGAGGAACTGG - Intronic
966917220 3:184591795-184591817 GAGAGAGGGCCTTGAGGACAGGG + Intronic
967028395 3:185584142-185584164 AAGGGATGGCCTTGAGGTGAAGG + Intronic
967811796 3:193766859-193766881 CAGGGAAGGCCTCGGGGTTGGGG - Intergenic
1202746678 3_GL000221v1_random:108905-108927 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
970157067 4:13152312-13152334 CAGGGAAGGACTCCTGGATATGG + Intergenic
970179335 4:13373477-13373499 CTGGGAGCTCCTTGAGGATAGGG + Intronic
970544637 4:17114950-17114972 CAGGGAAGGTCTTACTGATATGG - Intergenic
970702740 4:18762144-18762166 CAGAGAAAGCCTTTAGAATATGG - Intergenic
970966129 4:21930166-21930188 CAGCGGAATCCTTGAGGATATGG - Intronic
971092419 4:23360875-23360897 CAGGGAAGGCCTGAAGCATGGGG + Intergenic
971392983 4:26203376-26203398 CAGGGAAGGGCCTGGGGAGAAGG - Intronic
971632316 4:29009397-29009419 CAGAAAAGGCCCTGAGGAGAAGG + Intergenic
972158831 4:36198398-36198420 CAGGGAGGGCCTAAAGGTTAGGG - Intronic
972461071 4:39303071-39303093 CATGGCAGGCAATGAGGATAGGG - Exonic
972961067 4:44452318-44452340 CAGGGAAGGACATGATGGTATGG - Intergenic
973698371 4:53513144-53513166 CAGGGAAGGCCTGGAAGCGATGG - Intronic
973795277 4:54418902-54418924 CAGGGAAGGCAATGAAGAGAGGG + Intergenic
974070703 4:57121008-57121030 CAGGGAAGGCCATGAAAAGAAGG - Intergenic
974093244 4:57334629-57334651 AAGGGGAGGCCTTCAGGAAATGG + Intergenic
976287931 4:83388079-83388101 CAGGGAAGGCCATGAAGAGAGGG - Intergenic
977475279 4:97499691-97499713 CAGGGAAGGCCTCTGGGAGAAGG + Intronic
977870642 4:102086388-102086410 CAGGGGAGGCCTTTTGGAGAAGG - Intergenic
978229919 4:106385923-106385945 CAGGGAAGGCCTGAAGGCTGGGG - Intergenic
978467704 4:109027205-109027227 CAGGAAAGTACATGAGGATAAGG + Intronic
979731680 4:124030435-124030457 CAGGGAAGGCCTAAAGGGTGTGG + Intergenic
980418516 4:132526133-132526155 CAGGAAAGGCCATGAAGAAAAGG - Intergenic
980419220 4:132539426-132539448 CAGTGAAGGCCTTCAGAATTTGG + Intergenic
980495732 4:133586201-133586223 CAGGGAAGGCCTAGAGAATAGGG - Intergenic
981271780 4:142854080-142854102 CAGGGAAGGCCGTGAAGAAAGGG + Intergenic
981308615 4:143272814-143272836 CAGGGAAGGGCTTCAAGAGAAGG + Intergenic
981427070 4:144615969-144615991 CAGGTAAGGCCATGGTGATATGG + Intergenic
981609662 4:146579723-146579745 CAGGGAAGGACTTGTTGACAAGG + Intergenic
982090325 4:151875015-151875037 CAGGGGAGGCCTCGGGGAAAGGG + Intergenic
982623348 4:157732962-157732984 CAGTGGAGGCCTTTAGGATTTGG - Intergenic
983069713 4:163254104-163254126 CAGGGACAGCCTGAAGGATAGGG - Intergenic
983617438 4:169723953-169723975 CAGGGAAAGCCTCAGGGATAAGG + Intergenic
984076952 4:175195181-175195203 GAGGGAAGGACTTAAGGATAAGG + Intergenic
985004336 4:185518711-185518733 CTGGGAAGAGCTTGAGGAAATGG + Intronic
1202755100 4_GL000008v2_random:54393-54415 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
985714637 5:1448479-1448501 CTGGGAAGGCCCTGGGGGTAGGG + Intergenic
986151500 5:5133995-5134017 CATGGAAGGCCTTGAAGACTGGG - Intergenic
986257188 5:6110172-6110194 CAGAGAAGGCTGTGAGGATGGGG + Intergenic
986265889 5:6190054-6190076 CAGGAAAGGCCTTGCTGATATGG - Intergenic
987926946 5:24353834-24353856 CAGGGGAGGACTTTAGCATAGGG - Intergenic
989685452 5:44081383-44081405 AAGGGAAGGCCTTGTTGAGAAGG + Intergenic
991446178 5:66702522-66702544 CAAGGAAGGCCTTTCGGTTAGGG + Intronic
992009039 5:72509087-72509109 CAGGGAAGGGCATGAGGGAATGG + Intergenic
993001904 5:82388956-82388978 CAGTGAAGGGCTTGAGGACGTGG + Intergenic
994153119 5:96473001-96473023 CAGGGAAGGCCATGTGGCTATGG - Intergenic
994416473 5:99477851-99477873 CAGAGCAGGCCTGGAGCATATGG - Intergenic
994463495 5:100097322-100097344 CAGAGCAGGCCTGGAGCATATGG + Intergenic
995355058 5:111227722-111227744 CAGGGAGGGCATAGAGTATAGGG + Intronic
995855377 5:116586109-116586131 CAGTGAAGACACTGAGGATATGG - Intergenic
997456184 5:134019211-134019233 CAGGGAAGGCCGTGAAGGGAAGG + Intergenic
998000089 5:138618315-138618337 CAGGGCAGGCCATGAAGAGAGGG - Intronic
998504745 5:142663406-142663428 CAGGGAAGTCTTTGAGAAGATGG + Intronic
999377181 5:151094904-151094926 CGGGGAAGGCTTTCTGGATACGG - Intergenic
999584706 5:153077305-153077327 CAGGGAGGGACATGAGGACAGGG + Intergenic
1000210368 5:159102066-159102088 CAGGGAAGTCCTGGAAGAGATGG - Intergenic
1001284523 5:170412825-170412847 CAGGGAAGGTCTTGCTGAGAAGG - Intronic
1001304375 5:170560991-170561013 CAGGCAAGGCATTGTGGACAAGG + Intronic
1002136464 5:177110866-177110888 CAGAGGAGGCCTTCAGGATCTGG + Intergenic
1002902671 6:1423111-1423133 CATGCAGGGCCTTGAGGTTAGGG + Intergenic
1003065236 6:2899284-2899306 CAGGGAAGGCCATGAAGAGAGGG + Intronic
1003995487 6:11536921-11536943 CGGCGATGGCCTTGAGGATTAGG + Intergenic
1005105759 6:22222760-22222782 CGGGGAAAGCTGTGAGGATAGGG - Intergenic
1006471852 6:34234111-34234133 CAGGGAAGTCCTGGAGGAGACGG - Intergenic
1006753741 6:36396584-36396606 CAGGGAAGGCCTAAAGGCTGGGG + Intronic
1006902308 6:37511077-37511099 CAGGGAGGGCCTCGTGGAGAAGG - Intergenic
1007166890 6:39834931-39834953 CAGGGAAGGCTTTCTGGAGAAGG - Intronic
1008025586 6:46632428-46632450 CAGGGAAGGTCATGAAGAGAGGG - Intronic
1009433320 6:63590279-63590301 CAGGAAAGGCCATGAAGAGAGGG - Intergenic
1010454913 6:76043775-76043797 CAGGGAATGCCTGGTGGAAATGG + Intronic
1012110172 6:95220484-95220506 AAGGTTAGGCCTTGAAGATAAGG - Intergenic
1012333736 6:98027688-98027710 CAGGAAACTCCTTAAGGATAGGG - Intergenic
1013293139 6:108736029-108736051 CTGGTAATGCCTTGAGGATGGGG - Intergenic
1014141356 6:117947135-117947157 CAGGGAAGTCCTTGTTGAGAAGG + Intronic
1016861367 6:148721894-148721916 CAGGGAAGGACTACAGGAGAGGG - Intergenic
1017903948 6:158742937-158742959 CAGCAAACGCCTTGAGGAAAAGG + Intronic
1018308237 6:162480662-162480684 CAGGGAAGCCCTTGAAGATGGGG - Intronic
1018444039 6:163838932-163838954 CTGGGAAGACATTTAGGATAAGG + Intergenic
1018747436 6:166773241-166773263 CAGGGAAGGGGGTGAGGAGAGGG + Intronic
1019122079 6:169811703-169811725 CAGGGAAGGCATTGAGGCCTTGG - Intergenic
1019661726 7:2227982-2228004 CAGGGAGGGCCTGGAGAACATGG - Intronic
1019719354 7:2559078-2559100 CAGGGAAGGCCCCGAGGCTGCGG + Exonic
1020065818 7:5187904-5187926 ATGGGAAGGGCTTGAGGATGAGG - Intergenic
1021781193 7:24108543-24108565 CAGGGAAGGCCTCACTGATAAGG + Intergenic
1022159433 7:27694005-27694027 AAGGCCAGGCCTTGAGGACAAGG + Intergenic
1022329466 7:29363741-29363763 CAGGGAAGGCCTCCCTGATAAGG + Intronic
1022360499 7:29651994-29652016 CAGGGAAGACTTTTAGGAAAAGG + Intergenic
1022412214 7:30148174-30148196 CAGGGAAGGCTTTGCTGAGAAGG + Intronic
1023170585 7:37386806-37386828 CAGGGAAGGGCTTGGGGAGGAGG - Intronic
1024007363 7:45236273-45236295 CAGGGAAAGCCATGAAGAGAGGG + Intergenic
1024366562 7:48527201-48527223 CAGGGTAGGCCTGGGGGAGACGG + Intronic
1024405709 7:48976899-48976921 CAGGGAAGGCCATGAAGAGAGGG + Intergenic
1024621165 7:51158870-51158892 CAGGGAAGGCGTGGGGGACAGGG + Intronic
1026337913 7:69410664-69410686 CAGGGAAGACCCTGATGAGAGGG - Intergenic
1026444427 7:70471737-70471759 CAAGGAAGGCCTTGCTGAGAAGG + Intronic
1026794118 7:73354851-73354873 CAGGGAAGTGCTTGAGGCTGGGG + Intronic
1026851253 7:73724891-73724913 CAGGGAGGTCCTTGATGAGAAGG + Intergenic
1026914547 7:74112055-74112077 CTGGGAAGGCCCTGAGGCTGGGG - Intronic
1027229360 7:76263259-76263281 CGGGGAAGGCCCGGAGGCTATGG - Intronic
1027263364 7:76480514-76480536 CAGGGAAGGGCTTGGGGCCATGG - Exonic
1027314742 7:76978621-76978643 CAGGGAAGGGCTTGGGGCCATGG - Intergenic
1027624056 7:80526681-80526703 CAGGGAAGTCCTTTCGGTTAAGG + Intronic
1027748580 7:82110780-82110802 TAGAGAAGGCCTTGTGGCTAAGG - Intronic
1028506105 7:91571816-91571838 AAGGGAAGTCCTTGGGGGTATGG + Intergenic
1028520685 7:91727108-91727130 CTGGGAAGGGTTTGAGGCTAGGG + Intronic
1029465656 7:100723102-100723124 CAGGGGAGGCCTGCAGGACAGGG + Exonic
1029595381 7:101535074-101535096 CATGGAAGGGCTGGAGGACAAGG - Intronic
1029895145 7:103975874-103975896 CAGGGAAGGCCTCATGGAGAAGG + Intronic
1029899298 7:104022449-104022471 CAGGGAAGGCCTGAAGGCTGGGG + Intergenic
1031811473 7:126374869-126374891 CAGGGAAGGCCATGAAGAGAGGG - Intergenic
1031938194 7:127758429-127758451 CATGGAATTCCTTGAGGATAGGG - Intronic
1032854314 7:135821659-135821681 CAGGGAAGGCCTTGCTGAGGAGG - Intergenic
1033412298 7:141129118-141129140 CAGGGATGCCCTTGAGGGTACGG + Intronic
1033523002 7:142181594-142181616 CAGGGACGCCCTTGGGGCTAAGG - Intronic
1034295889 7:149972159-149972181 CAGGGAAGGGCGGGAGGATGGGG - Intergenic
1034349560 7:150407336-150407358 CAGGGAAGGCTTCTAGGAGAAGG + Intronic
1034810164 7:154124743-154124765 CAGGGAAGGGCGGGAGGATGGGG + Intronic
1036470517 8:9048594-9048616 CAGGGAAGGACATGGGGAAAAGG + Intronic
1036570917 8:9979278-9979300 CAGGAAAGTCCTTTAGGAGAGGG + Intergenic
1037935401 8:22912104-22912126 CAGAGAAGGCCACGAGGATAAGG + Intronic
1039434610 8:37551418-37551440 CAGGGAAGGCCTTGAAGAAATGG + Intergenic
1040711017 8:50188829-50188851 CAGTGCAGGCCTTTAGGATTTGG - Intronic
1042850547 8:73211991-73212013 CTGGGAAGGCCAACAGGATATGG - Intergenic
1042918864 8:73901994-73902016 CAGGGAAGGCCATGAAGGGAGGG - Intergenic
1044073338 8:87789149-87789171 CAGTGAACGCCTTCATGATATGG - Intergenic
1044793255 8:95869970-95869992 CAGAGAAGGCCTTATGGAAAAGG + Intergenic
1044797871 8:95922383-95922405 CAGGGAAGGCCTGGCTGAAAAGG - Intergenic
1044966683 8:97580614-97580636 CAGGGAAGGATTTGAACATAAGG + Intergenic
1045026879 8:98096061-98096083 CATGGAAGGACTAAAGGATATGG - Intergenic
1046597078 8:116273265-116273287 CATGGCAGGCCTTGAGGAATGGG + Intergenic
1047464492 8:125099302-125099324 CAGGGAAGGCCTTACTGATGAGG + Intronic
1047895274 8:129359743-129359765 CAGTGAAGGCCTTGTGGAGAAGG + Intergenic
1048309326 8:133306430-133306452 GAGGGAAGGCCATAAGGACAAGG + Intergenic
1049247103 8:141568744-141568766 CTGGGGAGGCCATGAGGAAATGG + Intergenic
1050413923 9:5394913-5394935 CAGGGAAGGCAATGAGGGTGAGG + Intronic
1050454397 9:5819339-5819361 CAGGGAAGGCCATGAAGGGAGGG + Intronic
1050582936 9:7080091-7080113 GAGGGAATGCCTAGTGGATAAGG - Intergenic
1050836267 9:10083135-10083157 CAGGGAAATCTTTAAGGATAGGG - Intronic
1052232578 9:26172117-26172139 TAGTGAAGTCCTTTAGGATATGG - Intergenic
1052990122 9:34514199-34514221 AAAGGAAGGGCTTGAGGATCTGG - Intronic
1053617863 9:39788331-39788353 CTGGGAAGGCCTTGTGAATCCGG - Intergenic
1054266296 9:62919100-62919122 CTGGGAAGGCCTTGTGAATCCGG + Intergenic
1055879232 9:80978819-80978841 CAGGGAAGGCCTTGAAGAAAGGG + Intergenic
1056615741 9:88164079-88164101 CAGGGAAGACATTGAGGATGTGG - Intergenic
1057234142 9:93345708-93345730 CAGGGACGGCCTTGCGGGTTGGG - Intronic
1057268504 9:93634163-93634185 CTTGGAAGGCCTTGTGGAAATGG - Intronic
1057294921 9:93829359-93829381 CAGGGAATGCCATGAGGAGGTGG + Intergenic
1057319609 9:94000429-94000451 TAGGGAAGGCTTGGAGGAAAAGG + Intergenic
1057321357 9:94016064-94016086 CAGGGCAGGCATTGAGTAAATGG - Intergenic
1057548515 9:96035263-96035285 CAGGGAATGCCTGAAGGCTAGGG + Intergenic
1057842047 9:98494341-98494363 CAGGGAAAGCCTCGGGGAGAAGG + Intronic
1058054005 9:100431706-100431728 TAGGGAGAGCCTTCAGGATATGG + Intronic
1058091911 9:100814384-100814406 CAGGGAAGGCCTGAAGGTTGGGG + Intergenic
1059382112 9:113934799-113934821 CAGGGAAGGCCTTGGGCGTGAGG + Intronic
1059894011 9:118838854-118838876 CAGGGAAGGCCATGAAGAGAGGG + Intergenic
1060975967 9:127765202-127765224 CAGGGAAGACCTTGCTGAGAAGG - Intronic
1061267351 9:129514473-129514495 CAGGGAAGGCCTGAAGGCTGGGG + Intergenic
1061397749 9:130352784-130352806 CAGGGAAGGCATGGTGGACAAGG - Intronic
1061995541 9:134181038-134181060 CAGGGAAGGCCTTGCAGGTGTGG - Intergenic
1062307175 9:135914536-135914558 TAGGGAAGGCCATGAAGAGAGGG - Intergenic
1062403097 9:136380995-136381017 CAGGGGAGGCCATGAGGCTGTGG + Intronic
1203686720 Un_GL000214v1:1462-1484 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
1203755939 Un_GL000218v1:126332-126354 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1203715316 Un_KI270742v1:138998-139020 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1203535906 Un_KI270743v1:39228-39250 CAGAGAAGGCCTTGAAGAGAGGG - Intergenic
1203649555 Un_KI270751v1:102591-102613 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1185507829 X:643042-643064 CCGGGAGGGCCTTGGGGATCTGG + Intronic
1186179266 X:6957152-6957174 CAGGGGAGGAGTTGAAGATAAGG + Intergenic
1186593883 X:10960107-10960129 GAGGTAGAGCCTTGAGGATAAGG - Intergenic
1186701380 X:12093750-12093772 CAGGGAAGGCCTCCTGGATGAGG + Intergenic
1187565066 X:20441378-20441400 CAGGCAAGGTTTTGAGGATGAGG + Intergenic
1189711181 X:43813993-43814015 CAAGGAAGGCCTCAAGGAGAAGG + Intronic
1189722383 X:43933386-43933408 CAGGGAAGGCCTCATGGAGAGGG + Intergenic
1192773275 X:74215755-74215777 CAGAGATGGCCTTAAGGACAAGG - Intergenic
1193919378 X:87406922-87406944 CAGGGAGGGCCTGAAGGCTAGGG - Intergenic
1194778378 X:97992704-97992726 CAGGGAAGGCCTCTCTGATAAGG + Intergenic
1195767929 X:108316491-108316513 CAGAGAAGGCCTTGCTTATAAGG + Intronic
1196416007 X:115471890-115471912 CAGAGAATGCCTTCAGGATGGGG - Intergenic
1196894564 X:120322087-120322109 CAGTGAAGGCCTTGAAGCCAGGG - Intergenic
1197386781 X:125812307-125812329 CAGTGAAGGCCTCTAGGATTTGG - Intergenic
1197696243 X:129553510-129553532 AAGGGAAAGCGTTAAGGATATGG + Intronic
1197722543 X:129755123-129755145 CAGGTCAGGGCTTGAGGAGATGG + Intronic
1197771199 X:130090578-130090600 CAGGGAAGGCTTTGAAAAGAAGG - Intronic
1199695081 X:150338277-150338299 TAGGTAAGGCCATGAGGATGGGG - Intergenic
1200141390 X:153904612-153904634 CAGGGGAGGCCTGGGGGAAAGGG + Intronic
1200234781 X:154462939-154462961 CAGGGAAGGGTTTGTGGAGAAGG + Intronic
1201169542 Y:11243937-11243959 CAGAGAAGGCCTTGAAGAGAGGG + Intergenic
1201534049 Y:15025834-15025856 CAGGTAAGGGTTTGAGAATAGGG + Intergenic