ID: 1075712608

View in Genome Browser
Species Human (GRCh38)
Location 10:124538558-124538580
Sequence CGCTGTGGCCCCATACCTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075712596_1075712608 4 Left 1075712596 10:124538531-124538553 CCCAAGTGGTGGGGTGGACCCCC 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712597_1075712608 3 Left 1075712597 10:124538532-124538554 CCAAGTGGTGGGGTGGACCCCCT 0: 1
1: 0
2: 1
3: 6
4: 83
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712594_1075712608 6 Left 1075712594 10:124538529-124538551 CCCCCAAGTGGTGGGGTGGACCC 0: 1
1: 0
2: 0
3: 6
4: 174
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712595_1075712608 5 Left 1075712595 10:124538530-124538552 CCCCAAGTGGTGGGGTGGACCCC 0: 1
1: 0
2: 1
3: 14
4: 205
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712590_1075712608 11 Left 1075712590 10:124538524-124538546 CCCTCCCCCCAAGTGGTGGGGTG 0: 1
1: 0
2: 0
3: 12
4: 187
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712591_1075712608 10 Left 1075712591 10:124538525-124538547 CCTCCCCCCAAGTGGTGGGGTGG 0: 1
1: 0
2: 0
3: 12
4: 156
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712587_1075712608 14 Left 1075712587 10:124538521-124538543 CCTCCCTCCCCCCAAGTGGTGGG 0: 1
1: 0
2: 1
3: 65
4: 1143
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data
1075712593_1075712608 7 Left 1075712593 10:124538528-124538550 CCCCCCAAGTGGTGGGGTGGACC 0: 1
1: 0
2: 0
3: 9
4: 162
Right 1075712608 10:124538558-124538580 CGCTGTGGCCCCATACCTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075712608 Original CRISPR CGCTGTGGCCCCATACCTGG GGG Intronic
No off target data available for this crispr