ID: 1075717389

View in Genome Browser
Species Human (GRCh38)
Location 10:124564828-124564850
Sequence TGTTAATTCATTTAAATATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 947
Summary {0: 1, 1: 1, 2: 4, 3: 81, 4: 860}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075717389_1075717391 5 Left 1075717389 10:124564828-124564850 CCATATATTTAAATGAATTAACA 0: 1
1: 1
2: 4
3: 81
4: 860
Right 1075717391 10:124564856-124564878 TGCAATGATCTGGATGAGATTGG No data
1075717389_1075717390 -5 Left 1075717389 10:124564828-124564850 CCATATATTTAAATGAATTAACA 0: 1
1: 1
2: 4
3: 81
4: 860
Right 1075717390 10:124564846-124564868 TAACAGCATTTGCAATGATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075717389 Original CRISPR TGTTAATTCATTTAAATATA TGG (reversed) Intronic
900072453 1:782339-782361 TTTTAATTGATTTAAACATGTGG - Intergenic
900970223 1:5988507-5988529 TATTAATTTATTTAAAAATAAGG - Intronic
901117422 1:6858899-6858921 TGTAAAGTCCTTTAACTATAAGG - Intronic
901178926 1:7326438-7326460 TGTGACCTCATTTAAAAATAAGG + Intronic
902020026 1:13338512-13338534 AGTGAATTCACTTAAATCTAAGG - Intergenic
902582955 1:17420440-17420462 TGGGAATTCATTTATATAAAGGG - Intronic
903191439 1:21658726-21658748 TTTTAATTTTTTTAAATCTAAGG + Intronic
905639417 1:39578326-39578348 TATTAATTAATTCAAATAAATGG + Intergenic
905653198 1:39669972-39669994 TTTGAATTCATTTAAATAAAAGG - Intronic
906079540 1:43075596-43075618 TGTTAATTTGTATAAATTTAAGG + Intergenic
906092103 1:43188914-43188936 TTTGAATTCATTTGAGTATATGG + Intronic
906371203 1:45255425-45255447 TGTTAATTCATTTGAATAGTTGG + Intronic
906563245 1:46776082-46776104 TGTTAATTCATTCATTTTTATGG + Intronic
907601161 1:55771137-55771159 TGTGAATGAATTAAAATATATGG - Intergenic
907647565 1:56259414-56259436 TGTTAATTCATTTAACACTTAGG + Intergenic
907979276 1:59465203-59465225 TGTTAATTAATTTGCATATGTGG - Intronic
908377031 1:63553845-63553867 TGTTTATTTATTTAGAGATAGGG + Intronic
908404118 1:63797222-63797244 TGTTAATTAATTTATGGATAAGG + Intronic
908602715 1:65758452-65758474 TTGTAATGCATTTAAATATTAGG + Intergenic
908880920 1:68732247-68732269 TGTCAAGTCATTAAAATATGAGG + Intergenic
909215968 1:72889580-72889602 AGTTAAATCATTTAAAAATTAGG - Intergenic
909249178 1:73329398-73329420 TGTTAACTCATTCATATTTATGG + Intergenic
909296591 1:73957006-73957028 TTTTGATTCATTTATATACATGG - Intergenic
909595180 1:77398549-77398571 TGTTAATTAATTTAATTTTCTGG + Intronic
910448782 1:87327069-87327091 AATTAATTCATTTAATTTTAAGG + Intergenic
910696376 1:90022140-90022162 AGATAAGTCATTTAAATCTAAGG + Intronic
911015151 1:93324179-93324201 TGCTAAATCATTTAAATCCAAGG - Intergenic
911256565 1:95639810-95639832 TTCAAATTCTTTTAAATATACGG + Intergenic
911515469 1:98863247-98863269 TTTTTATTTATATAAATATAAGG + Intergenic
911758862 1:101592865-101592887 TTAAAATTCATTTAAATAGATGG + Intergenic
911888562 1:103336911-103336933 AATTCATTCATTTAAATATATGG + Intergenic
912033228 1:105276190-105276212 TGATAATTGAAATAAATATAAGG + Intergenic
912693047 1:111819000-111819022 TATTAATTTATTTAGAGATAGGG + Intronic
912764006 1:112392557-112392579 TGTGAATTTATTTAGAAATAGGG + Intergenic
912907819 1:113725378-113725400 TGTAAATTCAGTTAAATTAATGG - Intronic
913140185 1:115933481-115933503 TGTTTATTCATTTATTTATTTGG - Intergenic
913304961 1:117419079-117419101 CTTTGATTCATTTAATTATATGG - Intronic
914051289 1:144135424-144135446 TGTTTATTAATTTAATCATATGG - Intergenic
914127892 1:144830018-144830040 TGTTTATTAATTTAATCATATGG + Intergenic
915371713 1:155356773-155356795 TGTTATTTCATTTAGAAATTAGG + Intronic
915631595 1:157156888-157156910 TGTTAATTTGTTTAGATATGAGG + Intergenic
915937105 1:160096022-160096044 TATGCATTCATTTACATATATGG + Intronic
915973424 1:160369785-160369807 TGTTTATTTATATAAATTTATGG + Intronic
916030499 1:160873577-160873599 TGTAAAATCATTTTAATATGTGG + Intergenic
916278386 1:163021201-163021223 AGTTAATTCATTTACATTCAAGG + Intergenic
916766176 1:167862962-167862984 TGTTTATTTATTTTCATATAAGG - Intronic
917038773 1:170778938-170778960 TTTTAATTTTTTTAAATACAGGG - Intergenic
917053725 1:170955135-170955157 TGTTAATTCATTTCTTTTTATGG + Intronic
917320225 1:173773408-173773430 TATTTATTTATTTAAAAATAGGG - Intronic
917553743 1:176062461-176062483 TGTTATTTTTTTTAAATATCAGG - Intronic
917577680 1:176341245-176341267 TGTTAATTCATTCATTTTTATGG - Intergenic
917673543 1:177298165-177298187 TGTTAATTCACTTAGAATTATGG - Intergenic
917949295 1:180013777-180013799 TGTTAATGCAGTTAAATCTTAGG + Intronic
918078842 1:181190482-181190504 TGTTAACTCATTTAATTCTCAGG + Intergenic
918158837 1:181878098-181878120 TGTTAATTCATTTCTTTTTATGG - Intergenic
918527746 1:185483486-185483508 TGTTTATTTTTTTAAAGATAGGG - Intergenic
918671373 1:187221348-187221370 TGATATTTCATTTATATATTTGG + Intergenic
918769108 1:188530510-188530532 GATTAATATATTTAAATATATGG - Intergenic
918849615 1:189669363-189669385 TGTTCATTCACTTAGAAATACGG - Intergenic
919257915 1:195149786-195149808 GGTTAATTCCGTTAAGTATAAGG - Intergenic
919364700 1:196642904-196642926 AGTTAATTCATTTACATTTAAGG - Intergenic
919446876 1:197717101-197717123 AGTTAATCCATTTCAAAATATGG - Intronic
920802326 1:209200981-209201003 TGTTAGTTTATTTAAAGACAGGG - Intergenic
921464212 1:215466225-215466247 AGTTAATTACTTTAAATATATGG - Intergenic
921516475 1:216098350-216098372 TGTTATTTGATTTTCATATATGG - Intronic
921729465 1:218561246-218561268 TGCTGTTTCATTTAAATTTAGGG - Intergenic
922267394 1:223996298-223996320 TTTTAATTGATTTAAACATGTGG - Intergenic
923272299 1:232367743-232367765 TGTTCAGTTATTTAAATTTATGG + Intergenic
923701600 1:236304881-236304903 TGATAATTTATTTACAGATAAGG - Intergenic
923768739 1:236918105-236918127 TATTTATTCATTTTAAGATAGGG + Intergenic
923899254 1:238307471-238307493 TGTTAATTAATTTCAATAAAAGG - Intergenic
924205137 1:241704580-241704602 TTGTAATTCATTTAATTATGTGG + Intronic
924609126 1:245559349-245559371 TATTAATTAATTAAAATTTAAGG + Intronic
1063274255 10:4547713-4547735 TGGAAATACATTTAAATAAATGG + Intergenic
1063550000 10:7022828-7022850 ATTTAATTCATTTACATTTAAGG - Intergenic
1064502114 10:15984829-15984851 TTTTAAATTATTTAAATTTAAGG - Intergenic
1064836031 10:19532076-19532098 TTATAATACATGTAAATATAAGG - Intronic
1065159081 10:22900570-22900592 GGGTAATTTATTTAAATAAAAGG + Intergenic
1066502224 10:36005464-36005486 TGTTAATTCATTCATTTTTATGG - Intergenic
1066564292 10:36704555-36704577 AGGTAATTCATGTAAATAGAAGG + Intergenic
1066726319 10:38399305-38399327 TTTTAATTGATTTAAACATGTGG + Intergenic
1066960934 10:42224545-42224567 TGTTTATTAATTTAATCATATGG - Intergenic
1067245622 10:44539806-44539828 TGTTAATTCATTTAGGATTATGG + Intergenic
1067291507 10:44946791-44946813 TATTAATTCATTTAAATCTCTGG - Intergenic
1067826684 10:49579197-49579219 TGTTACTTCATTTCAAAATCTGG - Intergenic
1068093572 10:52462636-52462658 TGTTAATAAAATTAAATAAAAGG - Intergenic
1068158163 10:53228009-53228031 TATTTATTGATTTATATATATGG - Intergenic
1068282747 10:54896872-54896894 AGTTAATTCAATTTAATATTAGG + Intronic
1068298172 10:55103069-55103091 TGTAACTTCATAGAAATATATGG + Intronic
1068382662 10:56277392-56277414 TGTTAATTCTTTTTTACATAGGG - Intergenic
1068708132 10:60100026-60100048 TTTTAATGCATTTGCATATATGG - Intronic
1068784256 10:60953144-60953166 TAAAATTTCATTTAAATATATGG + Intronic
1068806913 10:61206607-61206629 GGATAATTCATTTAAAAAGAAGG + Intergenic
1069824831 10:71248506-71248528 TGTTGAATAATTTAAATATTTGG + Intronic
1070515895 10:77205685-77205707 TGTTAAGTGATTTAAATACTTGG - Intronic
1071041972 10:81321147-81321169 TTTTAATTAATTTAAATATAGGG + Intergenic
1071161263 10:82747874-82747896 TGTTAATTCATTTCATTCTTAGG - Intronic
1071243244 10:83733784-83733806 TTTTAATTCATTTACATGTGAGG + Intergenic
1071696212 10:87874629-87874651 TGTTAATTCCTTTTGAAATATGG + Intronic
1072098120 10:92202633-92202655 TGATATTTCATTTATATGTAAGG + Intronic
1072132334 10:92507495-92507517 TGTGAATTAATTTAAATTTAAGG - Intronic
1072764668 10:98085657-98085679 TGTTAATTCATTCATTTTTATGG + Intergenic
1072908731 10:99480988-99481010 TGTTAATTCATTTAGGATTATGG - Intergenic
1073078942 10:100844720-100844742 TGTTAATTCATTTCTTTTTATGG + Intergenic
1073197304 10:101702854-101702876 TGTGTATGCATTTAAATATATGG + Intergenic
1073573442 10:104600343-104600365 TGTTTCTTTATTTGAATATAGGG + Intergenic
1073621132 10:105049688-105049710 TGTTAATTCACTTAGAATTATGG - Intronic
1074644616 10:115433300-115433322 GGATAATTCCATTAAATATAAGG - Intronic
1075224608 10:120616082-120616104 TGCTTTTGCATTTAAATATATGG + Intergenic
1075452891 10:122565312-122565334 TATTTATTCATTTAAAAAAAAGG - Intronic
1075717389 10:124564828-124564850 TGTTAATTCATTTAAATATATGG - Intronic
1076150952 10:128161647-128161669 TTTTTATTCATTTCAATAAAGGG - Intergenic
1076214260 10:128680104-128680126 TGTTAATTGGTTAAAACATAAGG - Intergenic
1076233013 10:128837731-128837753 GGCTAATACATTTACATATAAGG + Intergenic
1077531030 11:3094841-3094863 TATTAATTTTTTTAAACATACGG - Intronic
1079814109 11:25033694-25033716 TGTTAATTCACTTAGAATTATGG + Intronic
1080190468 11:29539673-29539695 TGTAAATTAAATTAGATATATGG + Intergenic
1080725270 11:34892902-34892924 TATTAAGTCATTTAAATATTAGG + Intronic
1081177157 11:39942999-39943021 TATTAATCCATTTAAATTCAAGG + Intergenic
1081304713 11:41497735-41497757 TTTTAATACATTTTAATATTTGG + Intergenic
1082623266 11:55450875-55450897 TGTTAATTCATTCCATTTTATGG + Intergenic
1083099361 11:60286852-60286874 ATTTAATTCATTTATATTTAAGG + Intronic
1084369451 11:68730492-68730514 TGTTAATTACTTTAAAAATCTGG + Intronic
1085373473 11:76034968-76034990 TTTTAATTTGTATAAATATAAGG + Intronic
1085699668 11:78734931-78734953 TGTTACTGCAGTTAAATCTAAGG + Intronic
1085793334 11:79515084-79515106 TGTTAAGTCACTAAAATATTGGG + Intergenic
1086182401 11:83969244-83969266 TGTTGATTCATTAAAAGCTAGGG + Intronic
1086448825 11:86895871-86895893 TGTTAATTCATCTTCATATCTGG - Intronic
1087165188 11:94996210-94996232 TGTATGTTCATTTAAAAATAGGG - Intronic
1087708725 11:101524557-101524579 TTTAAATACATTTAAATTTAAGG - Intronic
1087854551 11:103075799-103075821 TGTGCATTCATTCATATATAAGG - Intronic
1087886526 11:103489166-103489188 TGTTAACTCATTTAACCACATGG - Intergenic
1088139112 11:106594329-106594351 TTTTAATTTTTTTAAATACATGG + Intergenic
1088328132 11:108622668-108622690 TGTTTATTTATTTATTTATATGG - Intergenic
1088342206 11:108781177-108781199 TGTTAATTCATTTAGGCTTATGG + Intronic
1089819893 11:121215377-121215399 TGTTAATTCATTCATTTTTATGG - Intergenic
1091888650 12:4034933-4034955 TCTTAAGTGCTTTAAATATAAGG - Intergenic
1091953951 12:4620520-4620542 TTTGAATTCATTTTTATATAAGG - Intronic
1092356420 12:7799266-7799288 TATTAAATCAATTAAATACATGG + Intergenic
1092369655 12:7906223-7906245 TATTAAATCACTTAAATACATGG + Intergenic
1092451016 12:8601989-8602011 TTTTAATTAATTTTTATATATGG + Intergenic
1092519872 12:9258716-9258738 CTTTAATTCTTTTAAATTTATGG - Intergenic
1093386386 12:18560373-18560395 TTTTATCTCAATTAAATATAAGG - Intronic
1093517139 12:20001716-20001738 TTTTAATTCTTTTGAGTATATGG - Intergenic
1094062683 12:26331743-26331765 TGTTAAGCCATTAAAATTTAAGG - Intergenic
1094145475 12:27224366-27224388 TATTAAGGCATTAAAATATATGG + Intergenic
1094405631 12:30113045-30113067 TGTTAATTCACTTAAGATTATGG + Intergenic
1094642551 12:32290151-32290173 TGTAACCTCATTTATATATAAGG - Intronic
1094800780 12:34032306-34032328 TGTTAATTATTTTTTATATAGGG + Intergenic
1095113566 12:38326688-38326710 TGTTAATTATTTTTTATATAGGG + Exonic
1095120209 12:38408248-38408270 TGTGAATTTATTTGAACATAGGG + Intergenic
1095134749 12:38586430-38586452 TTTTAATGAATTTAAATATTTGG - Intergenic
1095666489 12:44807221-44807243 TGTCACTGCATTTAATTATAAGG + Intronic
1095766907 12:45906140-45906162 TGTAAATTGGTTTAAATACATGG + Exonic
1096723279 12:53540415-53540437 TATTAATTTATTTAAAGACAGGG + Intronic
1097558625 12:61172326-61172348 TTTTAATTCATTTAAATATAAGG - Intergenic
1097655749 12:62360653-62360675 AGTATATTCATTTAAATATAAGG - Intronic
1098306497 12:69107762-69107784 TCTTAATTCAGTTAAATCCAGGG + Intergenic
1098383179 12:69890907-69890929 TGTTAATGAAAATAAATATATGG + Intronic
1098475778 12:70901264-70901286 TGACAATTCATTTTAATCTAGGG - Intronic
1098869019 12:75795876-75795898 TGTTAAGTCATTGAGATAAAAGG - Intergenic
1099046165 12:77722619-77722641 TGTTAAATCATGTTATTATATGG + Intergenic
1099118795 12:78662085-78662107 TGTCATTTCATTTATATAAAGGG - Intergenic
1099472528 12:83069031-83069053 TGTTAATTCATTTGTTTTTATGG + Intronic
1099673328 12:85723484-85723506 TGTTAATTTAATGAAAGATAAGG - Intergenic
1099721659 12:86369314-86369336 TGTTAGTTTATTTACATTTATGG + Intronic
1099765966 12:86984774-86984796 TGTTGATTCATTTAAAGAAATGG + Intergenic
1099860947 12:88225367-88225389 TTTTAATTGATTTTTATATATGG + Intergenic
1100343511 12:93704279-93704301 GGTTAAGTCATTTACATATTTGG + Intronic
1100429489 12:94517922-94517944 TTTTAATTATTTTAAGTATACGG - Intergenic
1100721743 12:97366247-97366269 TGTTAATTCATTTTATGATATGG + Intergenic
1100757049 12:97762946-97762968 GGTAAATTAATTTGAATATATGG + Intergenic
1101025737 12:100603789-100603811 TTTTATTTCATTTTTATATATGG + Intronic
1101888514 12:108690505-108690527 TCTTAATTGATTTTAAAATATGG - Intronic
1101923411 12:108951676-108951698 TGTTAAATCATTTATATCCACGG - Intronic
1102129776 12:110517886-110517908 TGTACTTTCATTTAAAAATATGG + Intronic
1104249167 12:127074313-127074335 TCTTTTTACATTTAAATATAAGG - Intergenic
1105954943 13:25272715-25272737 TGTTAATTCATTTAGAATAATGG + Intronic
1105985755 13:25565033-25565055 TGTTAATTCATTCATTTTTATGG + Intronic
1106014585 13:25856523-25856545 TTTTAATTGATGTAAATTTAAGG - Intronic
1106177867 13:27346773-27346795 TATTTATTTATTTAAAGATAGGG - Intergenic
1106659823 13:31787440-31787462 TGTTTATTTTTTAAAATATAAGG + Intronic
1107724459 13:43284338-43284360 TTTTCAGTCATTTAAACATAGGG - Intronic
1107838393 13:44431128-44431150 TGTTTATTCATTTAACTTAATGG - Intergenic
1108142927 13:47444927-47444949 TCTTAATTCACTGAAATATCTGG - Intergenic
1108805429 13:54149168-54149190 TTTTTATTTATTTAAAAATATGG + Intergenic
1108967688 13:56330988-56331010 ACTTAATTAATTTAAAGATAGGG + Intergenic
1109036965 13:57275813-57275835 TGTTATTTAATTTAAAAAGAAGG - Intergenic
1109176271 13:59160759-59160781 TTTTGATTAATATAAATATAGGG + Intergenic
1109177828 13:59177337-59177359 TGTTTAATCATTCAAATAAATGG - Intergenic
1109213137 13:59557880-59557902 TGTTAATTCATTTCGTTTTATGG + Intergenic
1109533058 13:63678565-63678587 TATAAATTCATATAAATATAAGG - Intergenic
1109942666 13:69392246-69392268 TTTAAATTCATCAAAATATAGGG + Intergenic
1109991101 13:70059042-70059064 TTTTATTTTATTTTAATATATGG - Intronic
1110269025 13:73572198-73572220 TCTTAATTTATTAAAATATTAGG - Intergenic
1110585819 13:77191257-77191279 TGTTATTTTAATAAAATATAGGG - Intronic
1110997257 13:82127598-82127620 TTTTAATTGATTTAATTAAATGG + Intergenic
1111111604 13:83717650-83717672 TATTAAATAATTTAAATATTTGG - Intergenic
1111161793 13:84404609-84404631 TGTTAATGTATTTAAAGATGAGG + Intergenic
1111193103 13:84834957-84834979 TGTGAATACACTTATATATACGG + Intergenic
1111225268 13:85263074-85263096 TGTAAGTTCATTTAAAGAAAAGG - Intergenic
1111290262 13:86157705-86157727 TGTTCATTCAGTAAAATCTATGG - Intergenic
1111327705 13:86720964-86720986 TGTTAATTCACTTAAAATAATGG - Intergenic
1111461532 13:88549397-88549419 TGTTTATTGATTTACATATAGGG + Intergenic
1111724570 13:91989872-91989894 TTTTAATGCAATTCAATATATGG - Intronic
1111780899 13:92722401-92722423 TGGTAATCCAATAAAATATATGG + Intronic
1111858142 13:93666630-93666652 TTTTGATTCATTTAAAAACACGG + Intronic
1112076728 13:95922175-95922197 TGTTAATTCACTTAAAATAATGG - Intronic
1112077005 13:95925629-95925651 TTTTAATTTATTTCAATTTAAGG - Intronic
1112454528 13:99546596-99546618 TGTTCTTTCATTAAAAAATATGG - Intronic
1112568747 13:100574252-100574274 TGTTAATTCAGTTAAGCTTATGG - Intronic
1112683879 13:101800073-101800095 TGCTAACTCATTAAAATAAAGGG - Intronic
1112738601 13:102449240-102449262 TGTTAATTCATTTCTTTTTATGG - Intergenic
1112866658 13:103909635-103909657 TGTTACTGAATTTAAAGATAGGG + Intergenic
1112885426 13:104164718-104164740 AGTTAATTCATTTAAGTACTTGG + Intergenic
1112925138 13:104664634-104664656 TGGTGCTTCATTCAAATATATGG + Intergenic
1113194403 13:107785368-107785390 TGTTAATTCATTTCTTTTTATGG - Intronic
1113237289 13:108293080-108293102 TTTTAATTCATTTTTGTATATGG + Intronic
1113296683 13:108966790-108966812 TTCTAATTCATTTAAATTCATGG + Intronic
1114383545 14:22233401-22233423 TGGTAATTTATTTAAAAAAAAGG + Intergenic
1114488314 14:23078398-23078420 TGTTATTTCATTTTAGAATAAGG + Intronic
1114782515 14:25554169-25554191 TGTTAATTCTTTTAAAACTTCGG + Intergenic
1115133451 14:30080734-30080756 TGTAAATTCATTTAACAATATGG - Intronic
1115326206 14:32142518-32142540 TGTTAGTTTCTTTAAATATCTGG + Intronic
1115709500 14:36034857-36034879 AGTTAATTCATTTACATTCAAGG + Intergenic
1115927844 14:38456953-38456975 TGCTTATTCATTTATATATTGGG + Intergenic
1116110867 14:40578993-40579015 TGTTAATTAAGGTTAATATAAGG - Intergenic
1116214154 14:41989210-41989232 TGTTAAATCATGTAAAAAAAAGG - Intergenic
1116234642 14:42262716-42262738 TATACATTCATATAAATATAGGG - Intergenic
1116242564 14:42364268-42364290 TGTTTATTAATTTACACATAAGG - Intergenic
1116294061 14:43082408-43082430 TCTAATTTCATTTAAAAATAAGG + Intergenic
1116557831 14:46335288-46335310 CGTAAATGCATTTAAATTTATGG + Intergenic
1117018267 14:51541450-51541472 TTTTATTTCATTTTACTATAGGG - Intronic
1117021471 14:51575204-51575226 TGTTATTTAATTTTAAAATATGG + Intronic
1117686980 14:58263291-58263313 TGTAAATTTTTTTAAAGATAAGG - Intronic
1117877407 14:60268362-60268384 TGTTAATAAATTTGAAAATATGG - Intronic
1118145931 14:63136702-63136724 TTTTAAATGATTTAAATAAATGG + Intergenic
1118162786 14:63307687-63307709 TGTTAATTCATTTCTTTTTATGG - Intergenic
1118197108 14:63637621-63637643 TGTTAATTCATTTCTTTTTATGG - Intronic
1118651305 14:67898072-67898094 TTTTAATTCCTTTGGATATATGG - Intronic
1118754212 14:68826851-68826873 TTTAAATTTATTTAAATATTGGG - Intergenic
1119087702 14:71752660-71752682 TGTTAGTTCATTGCAATAAATGG + Intergenic
1119339352 14:73863007-73863029 TGTTAAATTTTTTAAGTATATGG - Intronic
1119895596 14:78217022-78217044 TGTGACTTTATTTGAATATAGGG - Intergenic
1119915295 14:78394641-78394663 AGTTAATTAATTTAAATGTTTGG + Intronic
1120109231 14:80533823-80533845 TGTTAATTGACTAGAATATAAGG - Intronic
1120350381 14:83349736-83349758 TGTTACTTCTTTAAAATATCTGG - Intergenic
1120427088 14:84362156-84362178 ATTTAATTCATATAAAAATATGG - Intergenic
1120478059 14:85013742-85013764 TGTTAATTCATTCCTTTATATGG - Intergenic
1120509751 14:85398973-85398995 AGTTAAGTCTTTAAAATATAAGG - Intergenic
1120633539 14:86922798-86922820 TGTTAATTTTTTTAAATAATTGG + Intergenic
1121420550 14:93810350-93810372 TACTAACTCATTTAAACATATGG + Intergenic
1121560953 14:94874972-94874994 TGTTATATCATTGTAATATATGG - Intergenic
1122514313 14:102296381-102296403 TGTATATACATATAAATATATGG - Intronic
1123390166 15:19863108-19863130 TGTAAATACATTTCAATAAATGG - Intergenic
1123421064 15:20133932-20133954 TGTTTATTAATTTAATCATATGG - Intergenic
1123530288 15:21140461-21140483 TGTTTATTAATTTAATCATATGG - Intergenic
1123897986 15:24847783-24847805 TGCTAATTGATTTACAAATACGG + Intronic
1124557601 15:30741671-30741693 TGTTAATTCATTTCTTTTTATGG - Intronic
1124673644 15:31663996-31664018 TGTTAATTCATTTCTTTTTATGG + Intronic
1125090374 15:35783950-35783972 TGTGAATTCATTTAATTTAATGG + Intergenic
1125090838 15:35790718-35790740 GTTTAATTCATTTATATTTAAGG + Intergenic
1125271100 15:37939673-37939695 TGATAATTCATTAAAATAGGTGG - Intronic
1126052381 15:44697825-44697847 TGTTATTTCCTTTACAGATAAGG - Intronic
1126661950 15:51041646-51041668 TGTAAATTCAATTAAAAATTTGG - Intergenic
1126694170 15:51312336-51312358 TGTTAATGTGTTTACATATATGG - Intronic
1126767689 15:52025498-52025520 TTTTAATTCCTTTAAATAGTTGG + Intronic
1126791396 15:52224608-52224630 TGTAGATACATTTAAATTTAAGG - Intronic
1126819183 15:52484551-52484573 TGTTAATTCAGGAACATATATGG - Intronic
1127452758 15:59132834-59132856 TGTTAATTATTTTAAAGAGAAGG + Exonic
1127738469 15:61871256-61871278 TGTGAACTCATTTTTATATATGG + Intronic
1128108341 15:65060493-65060515 TGTTACTTTTTTTATATATATGG + Intronic
1128181137 15:65605643-65605665 AATTACTTCATTTAAAGATAGGG - Intronic
1128856577 15:71023014-71023036 TGTTTCTTAATTCAAATATATGG - Intronic
1129289529 15:74553724-74553746 TGTTAATCCATTTCATTATAAGG + Intronic
1129977132 15:79831741-79831763 TGCTAATATATGTAAATATATGG + Intergenic
1131019085 15:89082787-89082809 TGTAAATTAATTTAAATATATGG + Intergenic
1131646860 15:94354113-94354135 TCTTACTTCATATATATATATGG - Intronic
1131718215 15:95136999-95137021 TGTTAAGTCATTGAAAGATTGGG + Intergenic
1131941312 15:97569249-97569271 TGTGCATGCAATTAAATATAAGG - Intergenic
1132293090 15:100716681-100716703 TGTTAATTCAATTAACTCTCAGG - Intergenic
1133344790 16:5062589-5062611 AGTTAATTCATTCAACTATTTGG + Intronic
1133533132 16:6674212-6674234 TGTAAATTTATTTAGAGATAGGG + Intronic
1133539859 16:6739535-6739557 TGTTAAATGTTTTAAAAATATGG - Intronic
1133779074 16:8922704-8922726 TTCTAATTCATCTAAATAGAAGG + Intronic
1134472634 16:14540777-14540799 TTTTATTTCATTTAGAGATAAGG - Intronic
1134802772 16:17100657-17100679 TGTTAATTAATTAAGATATATGG + Intergenic
1135007405 16:18838793-18838815 TGTTGATTTATTTTAAAATAAGG - Intronic
1135189114 16:20340529-20340551 TGATAATTCATTAAATAATAAGG + Intronic
1135880897 16:26255343-26255365 TGATAATTTATGTACATATAAGG + Intergenic
1136525616 16:30827960-30827982 TGTTTCTTCATTATAATATATGG - Intergenic
1136664438 16:31796650-31796672 TGTGAATTGATTTTTATATATGG + Intergenic
1137489759 16:48922467-48922489 ATTTAATCCATTTAAATTTATGG + Intergenic
1137506022 16:49054445-49054467 AGTGAGTTCATTTAAAGATAAGG + Intergenic
1137994634 16:53197081-53197103 TGTTAATTGTGTTAAAAATAAGG + Intronic
1138051121 16:53779609-53779631 TGTTTATTTATATAAATGTAAGG + Intronic
1138277750 16:55748505-55748527 TTGTAATACATTTAAATATTAGG - Intergenic
1138283645 16:55791572-55791594 TTGTAATACATTTAAATATTAGG - Intergenic
1138285357 16:55805415-55805437 TTGTAATACATTTAAATATTAGG + Intronic
1139055440 16:63177972-63177994 TGTTTACTCTTTTAAATATCAGG - Intergenic
1139084572 16:63568981-63569003 TGTTTATTCTTTTTAATACAGGG + Intergenic
1139228136 16:65253196-65253218 ATTTAATTCATTTTAATATTAGG - Intergenic
1139419286 16:66840082-66840104 TGTTAATTCATTTCTTTTTATGG - Intronic
1139911878 16:70402337-70402359 AGTTCATTCATTTTACTATATGG - Intronic
1140439584 16:74977035-74977057 TTTTAATGCAGTTAAATTTATGG - Intronic
1140563890 16:76017663-76017685 TGTCAAATTATTTAAAAATAGGG - Intergenic
1140604509 16:76518455-76518477 TGTCAATTCAATTCAATATAGGG - Intronic
1143056219 17:4163912-4163934 TTTTACTTCATTTTATTATAAGG + Intronic
1144020005 17:11232522-11232544 TGTGATTTTATTTAAAGATAGGG + Intergenic
1144380501 17:14692026-14692048 GTTTAAATCATTTACATATAAGG + Intergenic
1144674059 17:17150617-17150639 TGTTCATTCATTTACTTACAAGG + Intronic
1145368605 17:22287801-22287823 TGTTTATTGATTTAATCATATGG + Intergenic
1146781914 17:35681957-35681979 TTTTAATACAATTAAATAAAAGG - Intronic
1146837085 17:36119804-36119826 TGTTAATTCATTTAGAATAATGG + Intergenic
1147867884 17:43565515-43565537 TGCTCATTCATTTACATCTATGG - Intronic
1148402042 17:47372068-47372090 TTTTAATTCATTTACATTCAAGG + Intronic
1149344747 17:55723368-55723390 TGTTAATTCATTTAGGAATGAGG + Intronic
1149673884 17:58441233-58441255 TATAAATTTATTTAAATATCTGG + Intronic
1149852625 17:60049027-60049049 CCTTAGTTCATTTATATATATGG + Intronic
1150530142 17:65972165-65972187 TGTGAATCCTTTTAAATTTATGG - Intronic
1152152061 17:78607922-78607944 TGTGAATTCCTTTCAATAGATGG + Intergenic
1152418990 17:80181954-80181976 TGTTTATTCATTAAAAAATGGGG + Intronic
1152837260 17:82541561-82541583 AGTTAATACATTTAAAAATTTGG - Intronic
1153071066 18:1105256-1105278 TGTTCATTCATTCAATTTTAGGG + Intergenic
1153344180 18:4008195-4008217 TATTTATTTATTTACATATAGGG - Intronic
1154225472 18:12499569-12499591 TTTTAGTTAATTTATATATATGG - Intronic
1155228415 18:23750577-23750599 TGTTAAAACCTGTAAATATAAGG - Intronic
1155316710 18:24578869-24578891 TGTCATTTCATTTAATTCTATGG + Intergenic
1156064766 18:33127205-33127227 TATTTATTCATTTGAATGTATGG + Intronic
1156718247 18:40038364-40038386 GTTTAATTGAATTAAATATATGG + Intergenic
1156759924 18:40576434-40576456 TATTAATTAATTTAAATGGAGGG + Intergenic
1156768822 18:40694379-40694401 TTTTCATTAATTTAAATAAAAGG + Intergenic
1156925014 18:42565620-42565642 TGTAAATACACTTAAATTTATGG + Intergenic
1156959829 18:43012650-43012672 TGTTATTTTATTTATAAATAAGG + Intronic
1157041078 18:44039696-44039718 TGGAAATTCACATAAATATATGG + Intergenic
1157631346 18:49100173-49100195 TATTTATTCATCTAAAAATAAGG - Intronic
1157912792 18:51634466-51634488 AGTTAATTCTTTAAAATATGAGG + Intergenic
1158044854 18:53144142-53144164 TGTTAATGCTTTTAATAATATGG + Intronic
1158061030 18:53342028-53342050 GTTTAATTCATTTAAGCATAGGG + Intronic
1158131308 18:54155971-54155993 TGTTTATTCATTTATTTATTTGG - Intronic
1158244739 18:55419481-55419503 TGTTTTTTCATTTTAATGTATGG + Intronic
1158345839 18:56516254-56516276 TGTTCATTAATTTAATTAAAAGG - Intergenic
1159382725 18:67683521-67683543 AGTTAATTAATTTGTATATATGG + Intergenic
1159393348 18:67824286-67824308 TGTCAATTCATATAAACATTTGG - Intergenic
1159778308 18:72629628-72629650 TGCTAATTCTTTTAAATTGAAGG + Intronic
1159817234 18:73090434-73090456 TGTTAATTCATTTAGGATTATGG - Intergenic
1160669626 19:354467-354489 TGATAATTTATTTAAATATTTGG + Intergenic
1165430944 19:35772324-35772346 TCTGATTTCATTTAAATGTATGG - Intergenic
1165660557 19:37576786-37576808 TGTTAATTTAATTAAGTTTATGG - Intronic
1166059360 19:40315949-40315971 TATTTATTCATTTATAGATAGGG - Intergenic
1166267393 19:41693642-41693664 TATTAATTTTTTTAAAGATAAGG - Intronic
1166576824 19:43848878-43848900 TGTAAAATCATTTAAATGTAAGG + Exonic
1166629718 19:44395164-44395186 TGTTTATTCATTTATAAATTTGG - Intronic
1168470458 19:56636489-56636511 TGGTAATTCATTAAATTAAAAGG - Intergenic
1202690695 1_KI270712v1_random:88060-88082 TGTTTATTAATTTAATCATATGG - Intergenic
925095582 2:1197125-1197147 ATTTAATTCATTTACATTTAAGG - Intronic
925386054 2:3462486-3462508 TGTTAATTAAATTATGTATATGG + Intronic
925696720 2:6587904-6587926 TGATAATTCATAGAATTATAGGG + Intergenic
926185005 2:10683324-10683346 TGTTGGTTCTTTTAAATTTACGG - Intronic
926371148 2:12180088-12180110 TATTAATTTATTTGATTATATGG + Intergenic
927086996 2:19681942-19681964 TGTCAAGTCATGTAAAGATATGG - Intergenic
927410643 2:22821456-22821478 TAATAATTCATTTGTATATATGG + Intergenic
927424475 2:22966616-22966638 TATTTATTTATTTAAAGATAGGG + Intergenic
927727292 2:25436029-25436051 TGTTAACTCCTTTAAGAATATGG + Intronic
927735583 2:25518162-25518184 TCTTAATTCTTTTAAGTGTACGG - Intronic
928443890 2:31315981-31316003 TTTTAATTAATTTAAATTTAAGG + Intergenic
928498551 2:31862447-31862469 AGTTAAAACATTTAAATATAGGG - Intergenic
928695432 2:33844514-33844536 TGTTAAATCTTTTAAATGGACGG + Intergenic
928725437 2:34168028-34168050 TATTAATTCATTCAATTATTTGG + Intergenic
928807078 2:35171882-35171904 TGTTCATTCACTCAAATATTTGG + Intergenic
928849247 2:35722890-35722912 TGTTAATTTATTTAAATTCAAGG - Intergenic
929249471 2:39737160-39737182 ATTTTATCCATTTAAATATAAGG + Intronic
929375568 2:41282655-41282677 TGTTCATTCATTTAATTTTGTGG + Intergenic
929419348 2:41775160-41775182 TTTGAATTCATTTAAAAACAAGG + Intergenic
930129488 2:47834917-47834939 TGTACATTAATTTAAATATAAGG - Intronic
930254202 2:49070300-49070322 TATTAAGCCATTTAAATAAAAGG + Intronic
930727673 2:54697844-54697866 AGTTAAGTCATTAAAATAAAGGG + Intergenic
930878947 2:56250174-56250196 TGTTAATTCATTTAAGAGTTTGG + Intronic
930950614 2:57139577-57139599 TGATATTCCATTTTAATATAAGG - Intergenic
931081461 2:58776577-58776599 TCTTAGTTCTATTAAATATATGG - Intergenic
931326889 2:61235134-61235156 TGTTAATTAATTTGAATGTGGGG + Intronic
931544504 2:63367036-63367058 TATATATTCATATAAATATATGG - Intronic
932200117 2:69819015-69819037 TGGTATTTCATTTCAAAATAAGG - Intronic
932474534 2:71993817-71993839 TGTAAAATAATTTAAATAAAGGG - Intergenic
932966701 2:76484130-76484152 TGTTTATTCATCTAAAAAAATGG + Intergenic
932993459 2:76817243-76817265 TGATAATTAATTTTAATATATGG + Intronic
933049574 2:77586376-77586398 TGTTATTTGAATTAAATATAAGG + Intronic
933107804 2:78355373-78355395 AATTCATTCATTTAAATATCAGG - Intergenic
933206071 2:79510012-79510034 TGCTTATTCATTTAAATGTCAGG - Intronic
933546369 2:83717773-83717795 TCTTCTTTCATTTATATATATGG - Intergenic
933687594 2:85155677-85155699 TGTTAACTAATTTAAAGATGAGG + Intronic
933955716 2:87367944-87367966 TGTTTATTAATTTAATCATATGG + Intergenic
934239868 2:90259977-90259999 TGTTTATTAATTTAATCATATGG + Intergenic
934273321 2:91556777-91556799 TGTTTATTAATTTAATCATATGG - Intergenic
934323965 2:91992672-91992694 TGTTTATTAATTTAATCATATGG + Intergenic
934462315 2:94223243-94223265 TGTTTATTAATTTAATCATATGG + Intergenic
935101430 2:99999382-99999404 AGTTAATTAATTTAAGGATATGG - Intronic
935110478 2:100089713-100089735 TATTATCTCATTTATATATAAGG + Intronic
935340848 2:102058552-102058574 TGTGAAGTCAATTAAATGTAGGG - Intergenic
935461097 2:103335304-103335326 TTTTAACTCATTTAATCATATGG - Intergenic
935467671 2:103418255-103418277 TGTTAATTCATTTCTTTTTATGG - Intergenic
935559627 2:104546857-104546879 TGTACATTCAATTAAATGTAAGG + Intergenic
936124497 2:109775488-109775510 TATTATCTCATTTATATATAAGG - Intergenic
936220192 2:110595968-110595990 TATTATCTCATTTATATATAAGG + Intergenic
936740079 2:115494445-115494467 AGTTTCTTCAGTTAAATATATGG + Intronic
937540220 2:122940927-122940949 TAATAATTCTTTTAAAAATATGG + Intergenic
937757243 2:125555201-125555223 TATTCATTAATTTCAATATAGGG + Intergenic
937760781 2:125600883-125600905 TGTTTATTTTTTTAAATAGATGG + Intergenic
937771248 2:125722823-125722845 GTTTAATTCATTTCAGTATAGGG - Intergenic
938510225 2:131934948-131934970 TGTTTATTCATTTATTTATATGG - Intergenic
939319602 2:140601120-140601142 TGTTAATTTTTTTAAATATATGG + Intronic
939396890 2:141642280-141642302 TGTTTCCTCATTTAAATATGAGG + Intronic
939593143 2:144091194-144091216 TTTGAATTCATTTTTATATATGG - Intronic
939600579 2:144184740-144184762 TGTTATTTCATTTGCATACAGGG + Intronic
940125821 2:150322863-150322885 TGTTATTTCATTTATTTTTATGG + Intergenic
940833667 2:158496363-158496385 TGTATATTCATTTAAATTGAAGG + Intronic
941020313 2:160401253-160401275 ACTTTATTCATTTAAACATATGG - Intronic
941711519 2:168719158-168719180 TGATAATTCAGTTAGACATAGGG + Intronic
941723227 2:168834563-168834585 TTTTAATTCTTTTAAATAGAAGG + Intronic
941784438 2:169482107-169482129 TGTTCATGCATTTAGAAATAAGG - Intronic
941784556 2:169483303-169483325 AGTTCATGCATTTAAAAATAAGG - Intronic
941833431 2:169988785-169988807 TTTTAATTTTTTTAAAGATAGGG - Intronic
942040182 2:172053488-172053510 TGCTAATTCATTTTCAAATATGG - Intronic
942872470 2:180751729-180751751 TGTTAATTCATTTTACAATCTGG + Intergenic
942902528 2:181139042-181139064 TGGAAATTCAGTTGAATATATGG + Intergenic
943267541 2:185754089-185754111 TAGTAATTACTTTAAATATAGGG - Intronic
943393773 2:187306362-187306384 TTTTAATTCATTTGCTTATATGG - Intergenic
943397050 2:187351840-187351862 TTTTATCTCATTTAAATACATGG + Intronic
943451549 2:188047747-188047769 TTTTAATTCATTTAATCATGAGG - Intergenic
943550453 2:189332405-189332427 TTTCAATTCTTTGAAATATACGG - Intergenic
943746336 2:191466077-191466099 TGTGAATTCATTTAAAAAGTTGG - Intergenic
943848432 2:192683661-192683683 TTTTAATTCTTATTAATATAAGG + Intergenic
943978267 2:194511103-194511125 TGTTAATTCACTTAAGATTATGG - Intergenic
943978673 2:194517100-194517122 TGTTAATTCACTTAAGAAAATGG - Intergenic
944321214 2:198345365-198345387 TGTTAATTGATTTAAAACAAAGG + Intronic
944369948 2:198971094-198971116 GGTTAATTCTGTTAAATACATGG - Intergenic
944698995 2:202228911-202228933 TGGTAAATTATTTAAGTATAAGG - Intronic
945335516 2:208588387-208588409 TGTGACTTCATTTAAAAATAGGG + Intronic
945710872 2:213292750-213292772 TATTTATTCATTTTAACATATGG + Intronic
945717153 2:213371711-213371733 TGTTATTTAATCTAAATTTAGGG + Intronic
945830776 2:214782430-214782452 TGCAAATTCATTAAACTATATGG + Intronic
945876741 2:215285730-215285752 TGTGACTTCGTTTAAAAATAAGG - Intergenic
947094677 2:226552394-226552416 TGTTAAATCATTCAATTAGAAGG + Intergenic
947103678 2:226647348-226647370 TGTTAATTCACTTAAGATTATGG + Intergenic
947146754 2:227074773-227074795 TGTTACTTCATTTATAATTATGG - Intronic
947205349 2:227655911-227655933 TGTTAATTTATTTGAAAATAGGG + Intergenic
948230750 2:236347545-236347567 TGTTAATTCATTTCTTTTTATGG - Intronic
948782777 2:240333567-240333589 TGTTAATCTATTTAAATTAATGG + Intergenic
1168752295 20:291381-291403 TGTTTATTTATTTAGAGATAGGG - Intergenic
1169523522 20:6398643-6398665 TTTTGAATCATCTAAATATAAGG - Intergenic
1169587858 20:7106482-7106504 TGTTAATTCATTCCTTTATATGG + Intergenic
1169593624 20:7173217-7173239 TTTTAATATATTAAAATATAGGG - Intergenic
1169989315 20:11483186-11483208 TGTGACTTTATTTAAATATAAGG + Intergenic
1170338053 20:15293317-15293339 ACTTAATTCATTCAAAGATATGG - Intronic
1170628582 20:18048867-18048889 TATTAATATATTTAATTATAAGG + Intronic
1170966179 20:21073762-21073784 TTTTAATTCACATAAATTTACGG + Intergenic
1171189116 20:23146062-23146084 TGTTTATTCATTCTAATATATGG + Intergenic
1172206981 20:33169845-33169867 TGTTAATTCAGTGAAAATTAAGG + Intronic
1173068183 20:39735105-39735127 TGTGAATTGATTTGAAGATAGGG + Intergenic
1173361114 20:42345168-42345190 TTTTAATTAATTTAAATTTCAGG - Intronic
1173692621 20:44975485-44975507 TGAAAATTATTTTAAATATAAGG + Intronic
1174344436 20:49919570-49919592 TATTTATTTATTTAAAGATAAGG + Intergenic
1174861429 20:54095251-54095273 GATTTATTCATTTAAATACATGG - Intergenic
1175069547 20:56321611-56321633 TGTTAATTCATTCATTTTTATGG - Intergenic
1176361122 21:5997536-5997558 TGTTAATGTATTTAGAGATAGGG + Intergenic
1176593395 21:8666332-8666354 TGTTTATTAATTTAACCATATGG + Intergenic
1176661649 21:9641393-9641415 TGGTAATGAATTTAAATATTTGG - Intergenic
1177291301 21:19116532-19116554 TTTGAATTCATTTTTATATATGG + Intergenic
1177769485 21:25498521-25498543 TTTTAAAATATTTAAATATATGG + Intergenic
1178059925 21:28841485-28841507 TGTTAATTCATTCATTTTTATGG - Intergenic
1178159823 21:29899083-29899105 TGGTAAATCATTTAAAAAGAAGG - Intronic
1178315240 21:31561326-31561348 TGTTATCTCATTTATATAAATGG - Intergenic
1178434727 21:32547932-32547954 TTTAAATTTATATAAATATATGG + Intergenic
1179364648 21:40746214-40746236 TTTTAATTCATTTGCATTTAAGG - Intronic
1179394893 21:41030114-41030136 TGTTAATTCACTTAGGTTTATGG + Intergenic
1179535989 21:42052528-42052550 TGTTAATTCATTTCTTTTTATGG + Intergenic
1179762396 21:43541014-43541036 TGTTAATGTATTTAGAGATAGGG - Intronic
1180276242 22:10643460-10643482 TGTTTATTAATTTAACCATATGG + Intergenic
1180513312 22:16115166-16115188 TGTAAATACATTTCAATAAATGG - Intergenic
1180550722 22:16536473-16536495 TGTTTATTAATTTAATCATATGG + Intergenic
1181353914 22:22283488-22283510 TGTTTATTAATTTAATCATATGG - Intergenic
1181363409 22:22355973-22355995 TTTTATTTCAGTTACATATACGG + Intergenic
1181717862 22:24747288-24747310 TCTTAATTTTTTTTAATATATGG - Intronic
1182324253 22:29499971-29499993 TTTCAATTCTTTTAAATTTATGG - Intergenic
1182686847 22:32127819-32127841 TTTTAATTAATTTGACTATAAGG - Intergenic
1183149090 22:36023625-36023647 AGTTAAATGAGTTAAATATAGGG - Intronic
1184803336 22:46775841-46775863 AGTTAATTCCTTCAAAGATACGG + Intronic
949591735 3:5501431-5501453 TGTCAATTCTGTTAAATCTATGG - Intergenic
949625695 3:5864418-5864440 TGATTATTCATATAAATATTAGG + Intergenic
949790684 3:7788841-7788863 TATGCATTCATATAAATATATGG - Intergenic
950751498 3:15132422-15132444 GGTGAATCCATTTAAAAATAGGG - Intergenic
950925754 3:16739855-16739877 TTTCAATTCTTTTAGATATACGG + Intergenic
951014985 3:17721355-17721377 TATTAATTCAGTTAAAAAAATGG - Intronic
951165516 3:19481171-19481193 TGTTTATTTATATAAATTTATGG + Intronic
952096945 3:29965042-29965064 TGTTAATTCATTCATTTTTATGG + Intronic
952203551 3:31156197-31156219 TGTGAATGCATTTGGATATAAGG + Intergenic
952603679 3:35116617-35116639 TATTAATCCATTTTCATATACGG + Intergenic
953109241 3:39917828-39917850 TCTTAATACTTTTTAATATAAGG - Intronic
953893060 3:46769604-46769626 ATTTAATTCATTTACATTTAGGG - Intronic
954075675 3:48177699-48177721 TGATAATTCATTTAATAATAGGG - Intronic
954949466 3:54458060-54458082 ATTTAATTCATTTACATTTAAGG + Intronic
955523491 3:59797679-59797701 TTTTAATTCATTTAATAATTAGG + Intronic
955711019 3:61779181-61779203 TCTTAATGCATTTTAATCTATGG - Intronic
956561153 3:70576380-70576402 TGTTAATTCATTATAATTTGAGG - Intergenic
957000693 3:74880496-74880518 TGTTAAATTATTTAAATAGAAGG + Intergenic
957000709 3:74880817-74880839 TGTTAAGTTATTTAAAGAGAAGG + Intergenic
957397923 3:79667788-79667810 TGAAAATTTATTTTAATATAAGG - Intronic
957493670 3:80963148-80963170 TGTGGATTCATTTAAAAAAATGG - Intergenic
957701443 3:83720196-83720218 TAGAAATTCACTTAAATATAAGG + Intergenic
957854955 3:85863041-85863063 TGTCAAGTCAGTTAAATGTATGG + Intronic
957906482 3:86562708-86562730 TGTTAATTCATATATATTTATGG + Intergenic
958120031 3:89274553-89274575 TATTAATTCACATAAATCTATGG - Intronic
958530362 3:95322258-95322280 TGTTAATTTAATAAAATATGAGG + Intergenic
958537270 3:95419311-95419333 ATATAATTCAATTAAATATAAGG - Intergenic
958630477 3:96676325-96676347 TGTTAAAACATTTACATATTAGG - Intergenic
958739630 3:98053235-98053257 TGTTAATACATTCAATTTTAAGG + Intergenic
959096356 3:101960824-101960846 TTTTAATTTATATAAATGTATGG - Intergenic
959622781 3:108416292-108416314 TAAGAATTCATTTAAATATCAGG + Intronic
959880238 3:111436771-111436793 TCTTAATTCCTATAAATATTAGG + Intronic
959975727 3:112456807-112456829 TGTTAATATATTTAGAAATATGG - Intergenic
960092344 3:113654016-113654038 TTTGCATTCATTTAAATATTAGG - Exonic
960164173 3:114383197-114383219 TCATGATTCATTTAAATATAGGG + Intronic
960216003 3:115037866-115037888 TATTTATTTATTTAAAAATAAGG - Intronic
960354919 3:116639790-116639812 TGTTAATTTATGTAAAAACAAGG + Intronic
960371404 3:116845586-116845608 TGATATTACATTAAAATATATGG + Intronic
961352583 3:126313451-126313473 TGTGACCTCATTTAAAGATAGGG - Intergenic
962320483 3:134386224-134386246 AGTAAAATCATTTAAAAATAAGG + Intergenic
962617239 3:137138787-137138809 TGTTGATTCATTTTAATTTCTGG + Intergenic
963015273 3:140818417-140818439 TGTTAATTCACTTAAGATTATGG + Intergenic
963232570 3:142923570-142923592 TGTTAGATCAATTAAAAATAAGG + Intergenic
963429290 3:145177395-145177417 TGTTAATTTCTTTTAATATTAGG - Intergenic
963593546 3:147295769-147295791 TGTTAATTCATGACAATATTGGG + Intergenic
963596006 3:147325897-147325919 TGCGCATTCCTTTAAATATATGG + Intergenic
963614847 3:147523611-147523633 TGTTAATTCAATTAAGTTAATGG + Intergenic
963806083 3:149724410-149724432 TGTTAATTTAGTCAAATATTAGG - Intronic
963814683 3:149816338-149816360 TCTTATTTCATTAAAAAATATGG + Intronic
964191170 3:154002749-154002771 TTTTAATACATTTATATTTAGGG + Intergenic
964292086 3:155192745-155192767 TGTTTATTGTTTTATATATACGG - Intergenic
964843568 3:161021978-161022000 TTTTAATTCATTTATGTTTAAGG + Intronic
965017616 3:163178178-163178200 TGTATTTTTATTTAAATATATGG + Intergenic
965018767 3:163198345-163198367 TGTCCAGTCATTTAAATATTGGG - Intergenic
965066068 3:163850454-163850476 TGTTAATTCATTCATTTTTATGG - Intergenic
965243456 3:166232738-166232760 TGTTAAATTATTTAAGTTTAAGG + Intergenic
965437370 3:168668866-168668888 TGTTAACAAATTTAAACATAAGG + Intergenic
965438551 3:168684314-168684336 TGACAATTCATTTAAAAATCGGG - Intergenic
965525498 3:169712675-169712697 TTTTAATTCAGTTCAAAATATGG + Intergenic
965981629 3:174699188-174699210 TCTTAATTTAGTTAAATCTAAGG + Intronic
966020767 3:175206381-175206403 TGTTAATTCATTCATTTTTATGG - Intronic
966094380 3:176181041-176181063 TGTTAATTCATTCACTTTTATGG + Intergenic
966300813 3:178477724-178477746 TGTTAATGCATTTTGATATAAGG + Intronic
966449332 3:180039799-180039821 TATTTATTCATGTAAATATGTGG + Intergenic
966498717 3:180612274-180612296 AATTAATTCATATAAATTTAAGG + Intronic
966526584 3:180925691-180925713 TGTTAAATCATTCAAATTGATGG + Intronic
966585344 3:181617543-181617565 TCTTAATTCATTTAACTCAAAGG + Intergenic
967357895 3:188593766-188593788 TGTTAATTCATTCATTTTTATGG + Intronic
967438064 3:189474276-189474298 TGTTAATCCATTGAAATGTAGGG - Intergenic
967797556 3:193613901-193613923 TATTAATTCCTTTAATTACAAGG - Intronic
968129758 3:196186027-196186049 TGTTATTTTATTTAGATATTGGG + Intergenic
968246069 3:197149423-197149445 TCTAAAATGATTTAAATATATGG + Intronic
968792500 4:2677107-2677129 TTTTAGTTCATTTTTATATATGG + Intronic
969171859 4:5370323-5370345 TGTTTATTCATTCACAAATATGG - Intronic
969238253 4:5882540-5882562 TATTAAGTCATTTAATTCTATGG + Intronic
969931586 4:10636169-10636191 TGTGAATTTATTTGGATATAGGG + Intronic
970077529 4:12241382-12241404 TGTGACTACATTTAGATATAAGG + Intergenic
970215463 4:13754712-13754734 TGTTAATTCATTTCTTTTTATGG + Intergenic
970307755 4:14750903-14750925 TGTTAACTTATTTAAAAATGGGG - Intergenic
970557746 4:17252154-17252176 TGTTAATTATTTTTAATGTATGG + Intergenic
970805660 4:20028103-20028125 TTTTAATTCTTTTTAAAATATGG - Intergenic
970866176 4:20761336-20761358 TGTTAATTCATTTATGTATTAGG - Intronic
971573007 4:28237603-28237625 TTTTAATTTTTTTAAATTTATGG + Intergenic
971639680 4:29116491-29116513 TGATAGTTTATTTAAAAATAAGG - Intergenic
971904457 4:32708701-32708723 TGTTAATTGATAAAAATAAATGG - Intergenic
972057211 4:34818237-34818259 AGGTAATACATTTAAATATTTGG - Intergenic
972110145 4:35547754-35547776 TGTTAATTCACTTAGGTTTATGG - Intergenic
972293182 4:37710804-37710826 TGTTCATTCATTTAAGTTTTAGG + Intergenic
972835490 4:42865482-42865504 TGTTAATTCAACTCATTATATGG - Intergenic
973112537 4:46413288-46413310 TGTTAATTCAGTTAAACAAGTGG - Intronic
973173207 4:47170971-47170993 TCTTTATTCATTTATGTATATGG + Intronic
973787515 4:54347275-54347297 TGTTAATTCATTCATTTTTATGG - Intergenic
974210244 4:58763618-58763640 AGATAATTCCTTTAAAAATAAGG - Intergenic
974296406 4:60004894-60004916 TGTTAATTCACTTAGGTTTATGG - Intergenic
974335387 4:60537346-60537368 TCTTACTTCATTAAAAAATATGG + Intergenic
974598217 4:64040616-64040638 TGTTAATTCTTCTAAAAGTAAGG + Intergenic
974699709 4:65425232-65425254 TGTTAGTTCATTTAAACACAAGG + Intronic
974717188 4:65682451-65682473 TGTTACATCATTTATATATGAGG - Intergenic
974766740 4:66357085-66357107 TGTTAATTCACTTAGGAATATGG + Intergenic
974770566 4:66406145-66406167 TATTATTTCATTTGCATATATGG - Intergenic
975031581 4:69626158-69626180 TTTTAATTCTGTTAAATATTTGG + Intronic
975039497 4:69727302-69727324 TTTGAATTCATTCAAATAAAAGG - Intronic
975066280 4:70068399-70068421 TACTTATTCATTTAAACATAAGG + Intergenic
975307163 4:72863433-72863455 ATTTAAGTCATTTAAATTTAAGG - Intergenic
976042426 4:80903619-80903641 TGAAAATTCATATCAATATAAGG + Intronic
976299244 4:83502313-83502335 TGTTAATTAATTTACTTAAAAGG - Intronic
976489449 4:85651774-85651796 CATTAATTTAATTAAATATATGG - Intronic
976510084 4:85898541-85898563 TGGTAAATCATTTAAAAAGAAGG + Intronic
976860195 4:89655923-89655945 TGTTAATGCATTTGGAGATATGG - Intergenic
976869253 4:89770791-89770813 TGTGAATCAATTTAAATATTAGG - Intronic
977203405 4:94142989-94143011 GGTTAATCCATTTAAATGCAAGG - Intergenic
977205449 4:94160503-94160525 TGTTACTTTATTTATATATTCGG + Intergenic
979014022 4:115409040-115409062 TTTTAATTGATTTAGATAGAAGG + Intergenic
979226135 4:118287105-118287127 TGTTAGTTCATATGTATATATGG + Intronic
979335665 4:119458370-119458392 TTTTAATTGATTTAAACATGTGG - Intergenic
979343845 4:119561872-119561894 TTTTAGTTGATTTAGATATAAGG - Intronic
979420252 4:120495341-120495363 TGTTAATACATTTACATTTAAGG + Intergenic
979650743 4:123127554-123127576 TTTTAATAAATTTAAATAAAAGG + Intronic
979763996 4:124443338-124443360 ATTTAATTCATTTACATAAAAGG + Intergenic
980069244 4:128225775-128225797 TTTTAATACATTTACATATCTGG + Intergenic
980222163 4:129931674-129931696 TGTTAATACTTTTTAAAATAAGG + Intergenic
980286267 4:130782442-130782464 TATTAATTCATTTGATTTTATGG + Intergenic
980317920 4:131228959-131228981 TGGTACAACATTTAAATATAAGG - Intergenic
980395301 4:132206169-132206191 TTTTAATTTATATAAAAATAGGG - Intergenic
980413309 4:132451412-132451434 TGTTAATTGATTTGCATATGTGG - Intergenic
980546142 4:134265342-134265364 TGATAAATAATTTAAAAATAGGG + Intergenic
980833759 4:138164039-138164061 TGTATATTCATTTAAATTGAAGG - Intergenic
981374497 4:143998248-143998270 TGTTAAGTCATTTATATGTTGGG + Intronic
981415915 4:144493146-144493168 GGTTAATTTCTGTAAATATATGG - Intergenic
981427056 4:144615811-144615833 TGTTAAATCTATTATATATATGG + Intergenic
981809677 4:148759590-148759612 TGTAAATTTATGGAAATATATGG + Intergenic
981911762 4:149990159-149990181 TTTCATTTCTTTTAAATATATGG - Intergenic
982161490 4:152574406-152574428 TTTTAATTCTTTAAAATAAATGG - Intergenic
982601262 4:157453067-157453089 TATTAATGCATTGAAATGTAAGG + Intergenic
982764842 4:159334200-159334222 TTTTCATCCATTTAAAAATAAGG - Intronic
982913926 4:161181052-161181074 AGTATATTCATTCAAATATAAGG + Intergenic
983502604 4:168516538-168516560 TTTTAAACCATTTAAATGTAAGG + Intronic
983513543 4:168633615-168633637 TGTGATTTCATTTAAATGAAGGG - Intronic
983540699 4:168906629-168906651 TGTTTATTCATTTAGAGACAAGG + Intronic
983590173 4:169400000-169400022 TGTAAATTAAATTAAAAATATGG + Intronic
983737324 4:171078370-171078392 TGTCAATTCATTTTAATATCTGG - Intergenic
984130796 4:175873707-175873729 TGTTATCTCTTTTAAATATTGGG - Intronic
984412809 4:179416668-179416690 TTTTAATTGAGTTAAATATATGG - Intergenic
984542286 4:181054585-181054607 CGTTAATTCATTTAAAATAATGG - Intergenic
984683213 4:182635298-182635320 GATTTATCCATTTAAATATACGG + Intronic
984863702 4:184262445-184262467 TGTCAATAGATTTAAATATTAGG + Intergenic
985141531 4:186845150-186845172 TGCTCATTCTTTTAAATATTTGG + Intergenic
985217533 4:187670146-187670168 TGTTAATTCATTTCTTTTTATGG + Intergenic
985413746 4:189715153-189715175 TGGTAATGAATTTAAATATTTGG + Intergenic
986080381 5:4385749-4385771 TATTAATTCATTTGATTATTTGG + Intergenic
986519481 5:8598696-8598718 TGTGACTTCATTTGAAAATAGGG + Intergenic
986980630 5:13444351-13444373 TCTTAATCCACTTAAGTATAAGG + Intergenic
987609986 5:20190673-20190695 TTTCTATTCATTTACATATACGG - Intronic
987786867 5:22511956-22511978 TGTACATTCAATTATATATATGG + Intronic
988176825 5:27737727-27737749 TGTTATTAAATTTAAAGATAAGG + Intergenic
988258571 5:28852127-28852149 TATTACTGCATTTGAATATAAGG + Intergenic
988439832 5:31220478-31220500 TGTTCATTCATTTCATTATGAGG + Intronic
989015893 5:36933622-36933644 TTTTAATTTAATTAAATCTAAGG + Intronic
989671313 5:43919806-43919828 TGTGAATTCATGTAAATTTTAGG + Intergenic
990045880 5:51430835-51430857 TTTTAATTCATTTTCTTATAAGG - Intergenic
990629697 5:57654474-57654496 TGTTAATTTGTTTAATTATATGG - Intergenic
991262438 5:64681407-64681429 TGTTAATTGTTTTAAAACTAGGG - Intergenic
991517021 5:67448420-67448442 ATTTAATTCATTTATATTTAAGG + Intergenic
991581099 5:68155939-68155961 TGTGATTTCATTTAAAAATTGGG - Intergenic
993235236 5:85297547-85297569 TTTTAATACATTTCAAAATATGG - Intergenic
993418217 5:87662934-87662956 GGATAATTAATTTAAATATTAGG + Intergenic
993439746 5:87941020-87941042 TGTGAATTCAGTTGAAGATAAGG - Intergenic
993968250 5:94385088-94385110 CCTTACTTCATTTAAATAAATGG - Intronic
994060647 5:95472876-95472898 TGTTAATTCACTTAGAATTATGG + Intronic
994107975 5:95967408-95967430 TATTTATTTATTTAAAGATAGGG - Intergenic
994677662 5:102845564-102845586 TTTTCATTCATTTAAATATTTGG + Intronic
994745712 5:103675886-103675908 TATTACTTAATTTAAATATTAGG + Intergenic
994781085 5:104090838-104090860 TTTTCATTCCTTTAAATAAATGG + Intergenic
994842878 5:104949373-104949395 TCTTAAGTCATAGAAATATATGG - Intergenic
995403513 5:111767835-111767857 TTTTAATTTTTTTAAATATGGGG + Intronic
995478159 5:112568756-112568778 TCTTAATTAATTTAAATAGAAGG - Intergenic
995914277 5:117224729-117224751 TGTTAGATCATTTAAAAACATGG + Intergenic
995983400 5:118136665-118136687 TGATAAATCATTTAATTTTATGG + Intergenic
996001100 5:118364785-118364807 TTTTAAATCATTTAAGAATAAGG - Intergenic
996763231 5:127007867-127007889 CGTTAATACATATAAATATATGG + Intronic
996899758 5:128531227-128531249 TGTTAATTCATTCATTTTTATGG - Intronic
996947844 5:129092162-129092184 TGTTAGTACATTTAAATGTGAGG + Intergenic
997159379 5:131591363-131591385 TGTTAATTATTTTAACTATTAGG - Intronic
998917603 5:147032679-147032701 TGTTAATTCATTCTTATTTATGG + Intronic
1000077584 5:157806657-157806679 TGTAAATGCATGAAAATATAAGG + Intronic
1000151923 5:158511215-158511237 TATTTATTTATTTAAGTATAGGG + Intergenic
1000722154 5:164721463-164721485 GGTGATTTCATTTTAATATAAGG - Intergenic
1000772398 5:165371848-165371870 ATTTAATGCATTTAAATATAAGG + Intergenic
1000785020 5:165532425-165532447 TGTAACTTTATTTAAAGATAGGG + Intergenic
1000837167 5:166169806-166169828 TTTTAATTAATTTGTATATATGG - Intergenic
1001448866 5:171808686-171808708 TGTTAATTCACTTAAAATAATGG - Intergenic
1001458123 5:171883108-171883130 TGTTAATTCATTCCTTTATATGG + Intronic
1001840049 5:174868077-174868099 TTTTAATAAATATAAATATAAGG - Intergenic
1002947209 6:1774127-1774149 TTTTGATTCATTTATTTATAAGG - Intronic
1003885173 6:10515090-10515112 TATTAATTTATTGAAACATATGG - Intronic
1004718815 6:18246556-18246578 TGTCATTTCAATTAACTATATGG + Intronic
1005059873 6:21765874-21765896 TAATAATTAATTTAAATAAAAGG - Intergenic
1005094400 6:22098060-22098082 TGTTATTTCATTTATATATTTGG + Intergenic
1005129904 6:22494952-22494974 TGACAATACATTTAAATAAAAGG - Intergenic
1005233878 6:23737108-23737130 TGGGAATTTATTTAAAGATATGG - Intergenic
1005350721 6:24932655-24932677 TATAAATCCATTTAGATATATGG - Intronic
1005529461 6:26688265-26688287 TGTTTTCTCATTTAAACATATGG + Intergenic
1005541335 6:26813381-26813403 TGTTTTCTCATTTAAACATATGG - Intergenic
1005736331 6:28750864-28750886 AGTTAATTCTTTTAAATTTGAGG - Intergenic
1008416316 6:51244939-51244961 AGTTAATTCATGCAAATGTATGG - Intergenic
1008442771 6:51551910-51551932 TGTTAATGAATAAAAATATATGG - Intergenic
1008765531 6:54909190-54909212 TTATACTTCATTTGAATATATGG + Intronic
1008867129 6:56226147-56226169 TGTTAATTCATTTAACATCAGGG + Intronic
1008869054 6:56250263-56250285 TGTTAATTCATTTAAAACCTTGG - Intronic
1009012138 6:57855445-57855467 TGTTTTTTCATTTAAACATATGG - Intergenic
1009465693 6:63966182-63966204 TGTTCATTCATTTATTTTTATGG - Intronic
1009467092 6:63985039-63985061 TGTGACTTTATTTAAAAATAGGG + Intronic
1009603744 6:65838169-65838191 TGTTAAATGATCTAAATATATGG - Intergenic
1009681510 6:66898961-66898983 TGTTAATTTATTCACATTTATGG - Intergenic
1009689107 6:67003770-67003792 TCTTAATTATTTTTAATATAGGG - Intergenic
1009858940 6:69299872-69299894 TGTGATTCCATTTAAATTTAAGG + Intronic
1009901664 6:69814489-69814511 GGTTTATTCATTTAAATTTTGGG + Intergenic
1009979795 6:70714660-70714682 TGTTAGTAAAGTTAAATATACGG - Intronic
1010013045 6:71071906-71071928 GGTATATTCATGTAAATATATGG - Intergenic
1010265775 6:73864504-73864526 CATTATTTCATTTAAGTATATGG - Intergenic
1010474222 6:76266011-76266033 TGTTAATTCATTTAGGATTATGG + Intergenic
1010548679 6:77192010-77192032 TCTTATTTCATTTAACTGTATGG - Intergenic
1010699755 6:79029336-79029358 TGATAATTAATTTAACTTTATGG + Intronic
1010756220 6:79668681-79668703 TGTTGATACATTTATAAATATGG - Intronic
1011036682 6:82984817-82984839 TGTTTATTTATTTAGATACAGGG + Intronic
1011757382 6:90514869-90514891 TGTCATTTAATTTAAATAAAAGG - Exonic
1011839106 6:91474166-91474188 TGTTAATGCATTTTAATATTTGG + Intergenic
1012045837 6:94271934-94271956 TCTTAATTCCTGTATATATAGGG + Intergenic
1012047988 6:94302742-94302764 TGTTAATTCATTTATGATTATGG - Intergenic
1012110683 6:95227899-95227921 TGTTAAATCCTTTTAATCTAAGG - Intergenic
1012509794 6:99990530-99990552 TGTTAATTAAGTAAAATGTACGG + Intronic
1012567141 6:100671766-100671788 TGTCAATGCTTTTAAAAATAAGG + Intronic
1012726705 6:102822874-102822896 TATTCATTTATTTAATTATAAGG - Intergenic
1012808576 6:103927805-103927827 TGTTAAATAATTTAAAAATTTGG - Intergenic
1012861205 6:104561358-104561380 TGTTAAGTGATTAAAATATTTGG - Intergenic
1012923215 6:105241391-105241413 TGTTAATTCATTCCATTTTATGG - Intergenic
1013520292 6:110926515-110926537 TGTTAACTATTTTAAAAATAGGG - Intergenic
1013540285 6:111101449-111101471 TGTTAATGTATTTGATTATAGGG - Intronic
1013905959 6:115220180-115220202 TGTTAAGTCATTTAAAAATCTGG - Intergenic
1014223675 6:118823800-118823822 TTTAAATATATTTAAATATAAGG - Intronic
1014443488 6:121499742-121499764 TATTAATTAATTTAAACTTAAGG - Intergenic
1014633685 6:123818253-123818275 TTTTAATTCAATAAAATATGTGG + Intronic
1015505468 6:133981907-133981929 TGGAAATTCATTTAAAGCTATGG - Intronic
1015850805 6:137569659-137569681 TGCTAATTAATTAAAGTATATGG + Intergenic
1016006823 6:139097723-139097745 TGTTAATTTTTTTAAATATGTGG - Intergenic
1016035941 6:139383057-139383079 TTTTAATTCTTTTACACATACGG + Intergenic
1016084807 6:139900304-139900326 AGTTAATTCAATTTAATATAAGG + Intergenic
1016103490 6:140132175-140132197 TGTTTATTAATTTGCATATATGG - Intergenic
1016109143 6:140200200-140200222 TCTCAATTCATTTATATATAAGG + Intergenic
1016152177 6:140754965-140754987 AGTTAATTCTTTTCAATATAAGG - Intergenic
1016247235 6:141996979-141997001 TTTTAATTCATTTACATTTAAGG - Intergenic
1016282479 6:142434211-142434233 TGTTATTTGATATTAATATATGG - Intronic
1016616691 6:146057584-146057606 TCTTAACTCATTCAAACATAAGG + Intronic
1016881930 6:148920217-148920239 TTTCCATTCATTTAAATACATGG + Intronic
1017098012 6:150822257-150822279 ATTTATTTCATTTAAATGTATGG - Intronic
1017230283 6:152066362-152066384 TGTTCTTTCATCTAAATACAGGG - Intronic
1017350008 6:153429069-153429091 TGTCAATGCATTTATATACAAGG + Intergenic
1017614051 6:156225965-156225987 TGTGATTTCATATAAATTTAAGG - Intergenic
1018117050 6:160597053-160597075 CTTTAATTCTTTTAAATCTATGG + Intronic
1018332923 6:162751248-162751270 TATTACTTCTTTTAAAAATAAGG - Intronic
1018339624 6:162837888-162837910 CTATAATTTATTTAAATATATGG - Intronic
1018419950 6:163632242-163632264 TGATAATTTATATAAAAATATGG - Intergenic
1018770219 6:166963897-166963919 TGTTAAATTATTTAATTTTATGG + Intergenic
1019086091 6:169478891-169478913 TTTGAATTAATTTACATATATGG - Intronic
1020151208 7:5683251-5683273 TGTTTATTCATTAAAAAAAAAGG + Intronic
1020362401 7:7341729-7341751 TGTTTCTTCATTTATATATGAGG + Intergenic
1020369697 7:7418307-7418329 TGTTGCTCCATTTCAATATAAGG + Intronic
1020722477 7:11764850-11764872 TTATAATTCATTAAATTATAAGG + Intronic
1020729941 7:11868112-11868134 TGTACATTCATGTAAATTTAAGG + Intergenic
1020739054 7:11990214-11990236 TGTGACTGCATTTAAATATAAGG - Intergenic
1020861268 7:13494891-13494913 TGTTAATTCATTCATTTTTATGG - Intergenic
1020939900 7:14519028-14519050 AGTTTTTTCATTTAAATAAAAGG + Intronic
1021045133 7:15913408-15913430 TTTTAAGTTCTTTAAATATAGGG + Intergenic
1021179822 7:17493314-17493336 TTTACATTCATATAAATATAAGG + Intergenic
1022021939 7:26408368-26408390 GGTTAGTTCCTTTAAATATTGGG + Intergenic
1022744152 7:33152471-33152493 TGTTAGTACATTTGACTATAGGG + Intronic
1022869856 7:34465007-34465029 TGTTTAATTATTTATATATATGG + Intergenic
1022948041 7:35307199-35307221 TTTTAATTCTTTTAAATAAAAGG + Intergenic
1023005671 7:35863948-35863970 TTTTAATTTATTTAAACATGTGG - Intronic
1023035750 7:36130121-36130143 TGTAAATGCATATAAATACATGG + Intergenic
1023748448 7:43345752-43345774 TGTTAATTCATTCATTTTTATGG + Intronic
1023777647 7:43623420-43623442 TATTAATTCATATTAATTTATGG + Intronic
1024068427 7:45765387-45765409 TTTTAATTGATTTAAACATGTGG + Intergenic
1024357525 7:48429829-48429851 TGTTTATTTATTTATTTATATGG + Intronic
1024655487 7:51448204-51448226 CCTTAGTTCAGTTAAATATAGGG - Intergenic
1024928976 7:54649838-54649860 TGTTAATGGATTTAAATCTAGGG - Intergenic
1025771032 7:64507063-64507085 TATTAATTCTTTTAAAAATGTGG + Intergenic
1026397670 7:69973676-69973698 TGTTAATTGATATAATTATTAGG + Intronic
1027938721 7:84643693-84643715 TGATTAGTCATTTAAATAAATGG - Intergenic
1028104935 7:86865984-86866006 TGTTAATTTATTTGAAAAAAGGG - Intergenic
1028302166 7:89213802-89213824 TATTATCTCATTTAAAGATATGG - Intronic
1028364929 7:90017525-90017547 TGTTGATTTATTTAATTACATGG - Intergenic
1030141578 7:106309741-106309763 TGTTTATTCACTTAAGTCTAAGG - Intergenic
1030310398 7:108063279-108063301 TTTCAAGTCATTTAAATAAATGG - Intronic
1030316361 7:108118618-108118640 TTTTAATTAATATTAATATAAGG - Intronic
1030447291 7:109662867-109662889 TGTGTATACATATAAATATATGG + Intergenic
1030653547 7:112141578-112141600 TATTATATCATTTATATATAAGG - Intronic
1030688759 7:112511773-112511795 TGTTAATTTATTTGGAAATAGGG - Intergenic
1031193325 7:118583233-118583255 TCTTACTCCATTAAAATATAAGG - Intergenic
1031222427 7:118986333-118986355 TTTTTATTCATATAAATGTAAGG + Intergenic
1031629313 7:124027595-124027617 TTTTAATGCCTTTTAATATAAGG + Intergenic
1031631834 7:124052873-124052895 TGTTAACTCATTTAAATGTCTGG + Intergenic
1031675989 7:124612743-124612765 TGTTAAGTCAGTTTATTATAGGG - Intergenic
1031690912 7:124786677-124786699 TGTTAATTCATATTAATTTGGGG - Intronic
1031719974 7:125162372-125162394 TGTTAAATCTTTTAAAAACATGG - Intergenic
1031780490 7:125956108-125956130 TTTTATTTCATTTTAATTTAAGG + Intergenic
1031828507 7:126597112-126597134 TGTAACTTCATTTGAAAATATGG + Intronic
1031937134 7:127747239-127747261 TGACAATTCATTTAATGATAGGG - Intronic
1032678890 7:134161540-134161562 TGTTCATTAATATAATTATATGG - Intronic
1032905305 7:136358271-136358293 TGTTAATTCATTTAGAATAATGG - Intergenic
1033571041 7:142628367-142628389 TGTTTATTCTATTAAATGTATGG - Intergenic
1033765213 7:144481905-144481927 TGTTCATGCATTCCAATATATGG - Intronic
1033842226 7:145388511-145388533 CCTTAGTTCATTTAAATGTATGG - Intergenic
1036047845 8:5163870-5163892 TATAAAGTCATTGAAATATATGG - Intergenic
1036962523 8:13260685-13260707 TATTATATCATTTATATATATGG + Intronic
1037175011 8:15936974-15936996 TGTTACTTTATTTAAATAAAAGG + Intergenic
1037228442 8:16623992-16624014 TGTTAATTCCTTTAACAATATGG + Intergenic
1037317840 8:17615901-17615923 TGTTTATTCGTTTAGAGATAGGG - Intronic
1037556783 8:20032815-20032837 GGTTAATGCATTAAAAAATATGG - Intergenic
1038250084 8:25895440-25895462 TTTTAAATCATTTAATTATATGG + Intronic
1039130459 8:34258246-34258268 TGTTATCTCATTTAATTACAGGG + Intergenic
1039134948 8:34311285-34311307 AGTTAATTCATTTATATATGGGG + Intergenic
1039136665 8:34331950-34331972 CTTTAATTTATCTAAATATAAGG - Intergenic
1039614412 8:38943477-38943499 TATTTATTTATTTAGATATAGGG - Intronic
1040949471 8:52922290-52922312 TGATATTTCATTTGAATATTGGG - Intergenic
1041231262 8:55755124-55755146 TGTTTATTTATTTAGATATGGGG - Intronic
1041414830 8:57596290-57596312 TTATCATTCCTTTAAATATAGGG + Intergenic
1042086772 8:65117856-65117878 AATTAATTCATTTATATATCCGG + Intergenic
1042468736 8:69159502-69159524 TGTTTATTGAATTAAAAATATGG - Intergenic
1042879969 8:73476645-73476667 TGTTAATTCATTTTCATCAATGG - Intronic
1042991305 8:74643374-74643396 TGTTAATTCTTTCAAATTTCTGG - Intronic
1043442391 8:80287660-80287682 TGTTAATTAAATTAAACATCAGG - Intergenic
1043560059 8:81482597-81482619 TGTTAATCTATTAAAATATGTGG - Intronic
1043639995 8:82440235-82440257 TGTTCATTTGTTTAATTATAAGG + Intergenic
1044175423 8:89114870-89114892 TGTTAATTCATTTAGGATTATGG - Intergenic
1044296325 8:90531621-90531643 TTTTGATACATTTAAATATTGGG - Intergenic
1044772458 8:95650993-95651015 TGGGAATTCATTTTCATATATGG + Intergenic
1045208451 8:100068498-100068520 TGTGAATTTAATTAAATATAAGG - Intronic
1045354465 8:101373255-101373277 TGAGAATTCACTTTAATATAAGG + Intergenic
1045767729 8:105694690-105694712 ACTTAATTCATTTAATTAAAAGG - Intronic
1046036321 8:108845882-108845904 TGTTAATTTATTTCATTATCTGG - Intergenic
1046039173 8:108881079-108881101 TTTGAATTCATTTAAATTTCAGG + Intergenic
1046152691 8:110249150-110249172 TGTTAATTCATTCATTTTTATGG - Intergenic
1046173653 8:110546222-110546244 TTTTAAAGTATTTAAATATATGG + Intergenic
1046264377 8:111812587-111812609 TCTTAATTAATTTAATTTTATGG - Intergenic
1046560260 8:115827898-115827920 TTTTGATTCATTTAACTAGAAGG + Intergenic
1046925655 8:119785175-119785197 AGTTAGTTAACTTAAATATAAGG - Intronic
1047321546 8:123789995-123790017 TGTTAATTTATTTAAGTAGCTGG + Intronic
1047683633 8:127280800-127280822 TACTTATTCTTTTAAATATAGGG + Intergenic
1048184966 8:132231437-132231459 TGTGACTGGATTTAAATATAGGG + Intronic
1048629150 8:136221885-136221907 TGTTAATTCACTTAGAATTATGG - Intergenic
1048756448 8:137743918-137743940 TTTTATTTCATTTTTATATATGG + Intergenic
1050103357 9:2141261-2141283 TTTTAATTCCTTTAAAGATTTGG + Intronic
1050250315 9:3736562-3736584 TCTTAATTCATTTTAATTTGGGG + Intergenic
1050683949 9:8146417-8146439 TGTTAATTTACTTAAAATTAAGG + Intergenic
1050776393 9:9267465-9267487 TGTTAATTCTGTTAAATGTTTGG - Intronic
1051228760 9:14931390-14931412 TGTTACTTCACTTGAATATAAGG - Intergenic
1051393958 9:16598958-16598980 TGTTAATTTATTCATATTTAAGG - Intronic
1051442582 9:17101664-17101686 TGTTTATTTATTTAGAGATAGGG + Intergenic
1051472454 9:17461234-17461256 TGTTCATTCAGTTAGAAATACGG - Intronic
1051862413 9:21641343-21641365 TGTGATTTCATATAAATTTAAGG - Intergenic
1051940723 9:22502461-22502483 TGTTCATTAATTTAAACATTGGG + Intergenic
1052434303 9:28406572-28406594 TGTTAATTAATCTGAATATATGG - Intronic
1053213809 9:36254523-36254545 TTTTAATTTTTTTAAAGATAGGG - Intronic
1053261075 9:36664914-36664936 TTTTAATCCTTTTAAATTTATGG - Intronic
1053423891 9:37998457-37998479 TGTTTATTTATTTAAAGACAGGG + Intronic
1053692831 9:40603894-40603916 TGTTTATTAATTTAATCATATGG + Intergenic
1054272002 9:63036200-63036222 TGTTTATTAATTTAATCATATGG - Intergenic
1054304071 9:63403121-63403143 TGTTTATTAATTTAATCATATGG + Intergenic
1054402818 9:64727134-64727156 TGTTTATTAATTTAATCATATGG + Intergenic
1054436441 9:65212624-65212646 TGTTTATTAATTTAATCATATGG + Intergenic
1054493957 9:65809370-65809392 TGTTTATTAATTTAATCATATGG - Intergenic
1054965009 9:71014815-71014837 GTTTAATTCATTTACATTTATGG + Intronic
1055270754 9:74555456-74555478 CCTTAATACATATAAATATATGG + Intronic
1055345476 9:75332231-75332253 TGTTAATTCACTTAAAATAATGG - Intergenic
1055542125 9:77321140-77321162 TGATAAATCATAGAAATATAAGG - Intronic
1055585373 9:77753826-77753848 TTTTAATTAATTCAAGTATATGG - Intronic
1056343875 9:85670295-85670317 TGTTAATTCTTTTGACTATGGGG + Intronic
1056459175 9:86792641-86792663 TGTGACCTCATTTAAAAATAGGG + Intergenic
1057729582 9:97597023-97597045 TTTCTATTCATTTAAATATTCGG - Intronic
1057963018 9:99475398-99475420 TATTAATACATTAAAATATATGG - Intergenic
1058008305 9:99943866-99943888 TGTAATTTCCTTTAAATATTTGG + Intronic
1058240503 9:102552097-102552119 TGTTTATTTATCTAAATATTTGG + Intergenic
1058498310 9:105584516-105584538 TTTTATTTTATTGAAATATATGG + Intronic
1058527461 9:105874389-105874411 TGTTACTACATTTTAATAAATGG + Intergenic
1059038765 9:110789469-110789491 TGGGAATTCATTTAAAGATGTGG + Intronic
1059133134 9:111776262-111776284 TGTTTATCCATTCAAATATTAGG - Intronic
1060307300 9:122425987-122426009 TTTGAATTAATTTATATATATGG + Intergenic
1060652731 9:125343510-125343532 TGGAAATACATATAAATATATGG - Intronic
1061637690 9:131924436-131924458 TTTTAAATCATAAAAATATAGGG - Intronic
1061688807 9:132307396-132307418 GGGTAATACATCTAAATATAAGG - Intronic
1061752344 9:132788611-132788633 TGTTAATATATTTAAAGACAGGG + Intronic
1203639211 Un_KI270750v1:143236-143258 TGGTAATGAATTTAAATATTTGG - Intergenic
1186013131 X:5160316-5160338 CGTTAAATAATTTAAATTTATGG + Intergenic
1186035577 X:5419657-5419679 TTTTAATTTATTTAAATATTTGG - Intergenic
1186643030 X:11476803-11476825 TTTGAATTCATTTTTATATATGG - Intronic
1186654538 X:11598620-11598642 TGTTAATTCACTTAGAATTATGG + Intronic
1186777357 X:12878633-12878655 TTTTAATTAATTTAAATTTATGG + Intronic
1186941574 X:14514125-14514147 AGTTAATTCATTTAAAATAATGG - Intergenic
1187135184 X:16541151-16541173 TGTTAATTCACTTAAAATTATGG - Intergenic
1187752020 X:22477328-22477350 TGATAATTCATTTTAAGATTTGG + Intergenic
1187951740 X:24477540-24477562 TGTTAACACATGTAAATATATGG - Intronic
1187977314 X:24716030-24716052 TGTTAAGTCATTTTAATCAATGG - Intronic
1187998395 X:24954329-24954351 TATTAATTCCTTTAAAAATCTGG + Intronic
1188066849 X:25672532-25672554 TGTTAATTCAATTAAATAACAGG - Intergenic
1188132613 X:26455770-26455792 TGTTTATTTATTTAAAGATGGGG + Intergenic
1188455339 X:30358021-30358043 TTTTGCTTCATTTAAATGTATGG - Intergenic
1188799279 X:34507119-34507141 TGTTAATTCATTCATTTTTATGG + Intergenic
1188983015 X:36744143-36744165 AGATCATTCATTTATATATATGG + Intergenic
1188991275 X:36823562-36823584 TGTGAAGCCATTTAAATCTAAGG - Intergenic
1189064373 X:37790766-37790788 TTTTATTCAATTTAAATATAGGG - Intronic
1189218640 X:39350461-39350483 TGTTAATTCATTCCTATTTATGG - Intergenic
1189291821 X:39891484-39891506 AGTTAATTCATGCAAATACAAGG + Intergenic
1189766637 X:44378849-44378871 TGTTGATTCATTTTACTAAAAGG - Intergenic
1189932368 X:46027080-46027102 TATTAATTGATATAAATCTATGG + Intergenic
1189980035 X:46500532-46500554 TGTGAATTCTTTGATATATAAGG + Exonic
1190151043 X:47948701-47948723 TTTTAATTCTTTTACATTTAAGG - Intronic
1190331863 X:49240989-49241011 TGTTAACTCATTTAATTCTCAGG + Intronic
1190477843 X:50845788-50845810 TTTTAATTAATTTGACTATAAGG + Intergenic
1191189674 X:57653325-57653347 TGTTAATCCTTTTCAAAATATGG + Intergenic
1192215500 X:69155504-69155526 TGTTAATACATTTTACTAAAGGG + Intergenic
1192423616 X:71055952-71055974 TGTTGTAACATTTAAATATAGGG - Intergenic
1192709850 X:73568933-73568955 TGTTAATTTGTTTTTATATAAGG + Intronic
1192710058 X:73572232-73572254 TGTTAATTCATTTAGAATAATGG + Intronic
1193463721 X:81821251-81821273 GGTTAATTTATTTATAGATATGG + Intergenic
1193691110 X:84643969-84643991 TGTTAAGCTATTTAAATTTAAGG - Intergenic
1193779450 X:85684459-85684481 TGTTAATTCATTTCTTTTTATGG + Intergenic
1193848011 X:86498711-86498733 TGATATTTCATTAAAATTTATGG - Intronic
1193918597 X:87398840-87398862 TGTTAATTCAATTATATAAAGGG + Intergenic
1193920231 X:87415843-87415865 TGTTAATTCATTTAGGATTATGG + Intergenic
1193922143 X:87442540-87442562 TGTTAAATCAATTAAGAATAAGG + Intergenic
1194180744 X:90708796-90708818 TGTTAATTCATTTAGGACTATGG + Intergenic
1194382622 X:93213975-93213997 TGTTATTCCATTTAAAAATCAGG - Intergenic
1194412001 X:93568587-93568609 TGTTAATTCATTCATTTTTATGG + Intergenic
1194472815 X:94318408-94318430 TGTTCTTTCATTTAAATCTAAGG + Intergenic
1194546737 X:95244800-95244822 TGTGATTTCATATAAATATTAGG - Intergenic
1194801015 X:98272793-98272815 TTTTAATTCATTTAAATTTATGG - Intergenic
1194861485 X:99004028-99004050 TTTTAATTCACTTCAAAATATGG - Intergenic
1194895535 X:99435074-99435096 ATTTAATTCATTTATATTTATGG - Intergenic
1195591539 X:106634012-106634034 TGTTTATTCATGTAATTATTTGG - Intronic
1195816967 X:108898542-108898564 TTTTAATCCATTTAAATTAAAGG - Intergenic
1195978561 X:110554205-110554227 ACATAATTCATATAAATATATGG - Intergenic
1195984721 X:110616314-110616336 TGTTAATTCATTCATATTTATGG + Intergenic
1196647889 X:118137432-118137454 TTTTAATTCTTGTAGATATATGG + Intergenic
1197144177 X:123153008-123153030 TGTTAATACATGTGAAAATATGG + Intergenic
1197162148 X:123336151-123336173 TGTAAATTATTTTAAACATAAGG - Intronic
1197224270 X:123940759-123940781 TGTTAACACATAGAAATATAAGG + Intergenic
1197484367 X:127029438-127029460 TTTTAATTCATTAAAATGAATGG + Intergenic
1197819025 X:130527982-130528004 TGTCATCTCATTTAAAAATAAGG - Intergenic
1198691035 X:139284828-139284850 TGTGAGTGCATTTGAATATAGGG + Intergenic
1198934453 X:141891366-141891388 TGTTAAATCATTTAAATTTCAGG + Intronic
1199043614 X:143142701-143142723 TTTTAATTCTTTTAAAAAGATGG - Intergenic
1199941734 X:152634282-152634304 TGGGACTTCAATTAAATATATGG + Intergenic
1200245956 X:154525653-154525675 TGTGAAATCAGTTAAATGTATGG + Intergenic
1200319721 X:155174798-155174820 TATTAATGCATTTGATTATAGGG + Intergenic
1200527406 Y:4290952-4290974 TGTTAATTCATTTAGGACTATGG + Intergenic
1201580355 Y:15504926-15504948 ATTTAATTCATTTACATTTAAGG - Intergenic
1201635131 Y:16114567-16114589 TTTTAATTTGTTTAAATATTTGG + Intergenic
1201721474 Y:17103037-17103059 TGTTATTTCAATTAATCATATGG + Intergenic
1202628242 Y:56882403-56882425 TGTTAAGTCAATTACAAATATGG - Intergenic