ID: 1075717391

View in Genome Browser
Species Human (GRCh38)
Location 10:124564856-124564878
Sequence TGCAATGATCTGGATGAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075717389_1075717391 5 Left 1075717389 10:124564828-124564850 CCATATATTTAAATGAATTAACA 0: 1
1: 1
2: 4
3: 81
4: 860
Right 1075717391 10:124564856-124564878 TGCAATGATCTGGATGAGATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075717391 Original CRISPR TGCAATGATCTGGATGAGAT TGG Intronic
No off target data available for this crispr