ID: 1075728356

View in Genome Browser
Species Human (GRCh38)
Location 10:124622192-124622214
Sequence CAGCAGTCCTCAAGGACAAA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 162}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075728352_1075728356 -10 Left 1075728352 10:124622179-124622201 CCCTGGTTACAGCCAGCAGTCCT 0: 1
1: 0
2: 0
3: 10
4: 135
Right 1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG 0: 1
1: 0
2: 0
3: 18
4: 162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075728356 Original CRISPR CAGCAGTCCTCAAGGACAAA CGG Exonic
901415326 1:9112338-9112360 AAGAAGTCCTCAAGGCCAAAGGG - Intronic
902540003 1:17147590-17147612 TAGCAGTCCCCAAGCACCAAGGG - Intergenic
905383663 1:37583510-37583532 CAGGAGTCCTCATCGATAAAAGG + Intronic
906417799 1:45634979-45635001 CAGAGGACCTCCAGGACAAAGGG + Intronic
908667532 1:66509835-66509857 CAGCTGTCCTGAAGCCCAAAGGG + Intergenic
911896126 1:103437073-103437095 CAGCAATGTTCAAGGAAAAAGGG - Intergenic
913580904 1:120225870-120225892 CAGCAGTCCTCAAAGGCATCAGG - Intergenic
913627275 1:120672529-120672551 CAGCAGTCCTCAAAGGCATCAGG + Intergenic
914562836 1:148837308-148837330 CAGCAGTCCTCAAAGGCATCAGG - Intronic
914609993 1:149292914-149292936 CAGCAGTCCTCAAAGGCATCAGG + Intergenic
918854915 1:189739790-189739812 GAGAATTCCTCAAGGTCAAAAGG - Intergenic
921277120 1:213531608-213531630 CAGCAGTTCTCCAGGACAGCTGG + Intergenic
921559788 1:216643585-216643607 CAGGAGTCATGAAGGTCAAATGG - Intronic
922018684 1:221680923-221680945 CAGAAGCCCTCAAGGAGAGAAGG - Intergenic
922639588 1:227214943-227214965 CTGCAATTCTCAAAGACAAAAGG + Intronic
923981432 1:239328374-239328396 CTGCTGTCCTCAAGGGCCAAGGG + Intergenic
1062781127 10:208825-208847 CATAAGTCCTCAAGGAAATAAGG - Intronic
1071112243 10:82173283-82173305 AAACAGTCCTGAATGACAAATGG - Intronic
1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG + Intergenic
1075309832 10:121404934-121404956 CAGCCCTCCTGGAGGACAAACGG + Intergenic
1075728356 10:124622192-124622214 CAGCAGTCCTCAAGGACAAACGG + Exonic
1076014930 10:127020013-127020035 CAACAGCCCTGAAAGACAAAAGG - Intronic
1082177907 11:49082888-49082910 CCGCAGTCCTCATCAACAAAGGG + Intergenic
1082767589 11:57181461-57181483 CACCAGGCCACCAGGACAAATGG + Intergenic
1083998401 11:66283467-66283489 CCTCAGTCCTCAGGGGCAAAAGG - Intronic
1084449917 11:69230507-69230529 CAGCAGGCCTCAAGAAGAACTGG - Intergenic
1085296554 11:75434819-75434841 CAGCAGACCTCAAGGCAGAAGGG - Exonic
1086761332 11:90634982-90635004 GAGAAGACTTCAAGGACAAAAGG - Intergenic
1088140619 11:106611696-106611718 CACCAGTTCTCAAGACCAAAGGG + Intergenic
1091281732 11:134385411-134385433 CAGGAGTTCTCATGGGCAAATGG + Intronic
1096836847 12:54356634-54356656 CAGCCGTCTTCCAGGACAATAGG - Intergenic
1097925788 12:65124824-65124846 GAGCAGTCTTGAAGGTCAAAGGG + Intergenic
1100033644 12:90224084-90224106 CAGTAGTTATCAAGGGCAAAGGG + Intergenic
1101409310 12:104456300-104456322 CACCATTCCTCAAGGCAAAAGGG - Intronic
1101601855 12:106216502-106216524 CAGCTTTCCTCAAGTACAACTGG + Intergenic
1102897031 12:116606576-116606598 GAACCATCCTCAAGGACAAATGG + Intergenic
1103202622 12:119100768-119100790 CAGCATTCCTCAGAGATAAATGG + Intronic
1103502876 12:121417977-121417999 CAGAAGTCATCAAGCACTAAAGG - Intronic
1109403409 13:61865184-61865206 CTGCAGTGGACAAGGACAAAAGG + Intergenic
1110392060 13:74985139-74985161 GAACAGTTCTCAAGGACAAGGGG + Intergenic
1111678803 13:91418949-91418971 AATCAGTCCTGAAAGACAAAAGG + Intronic
1114705339 14:24720695-24720717 AAACAGTCCTCAAAGGCAAATGG + Intergenic
1116563319 14:46412216-46412238 CAGAAGTTCTAAAGGAAAAAAGG - Intergenic
1117905955 14:60587042-60587064 AAGGAGTCCTCAAGCACACATGG - Intergenic
1118963382 14:70556391-70556413 TAGCAGTCATCTTGGACAAAGGG - Intergenic
1119895765 14:78218777-78218799 CAGAAATCCTCAAGGATTAAAGG - Intergenic
1120330740 14:83090322-83090344 CAGCAGGTCTAAAGGACAGAGGG + Intergenic
1120736155 14:88055505-88055527 CAGCAGTTAACAAAGACAAAGGG - Intergenic
1121358358 14:93233171-93233193 GAGGAGTCCTTAAGAACAAATGG + Intergenic
1121736139 14:96219456-96219478 CAGAAGTCCCCAAGGGCATAGGG - Intronic
1121736246 14:96220149-96220171 CAGAAGTCCCCAAGGGCATAGGG + Intronic
1127194673 15:56570782-56570804 CAGCAGTTAAAAAGGACAAAGGG + Intergenic
1127384041 15:58452975-58452997 CAGCTGTCCTTAGTGACAAATGG - Intronic
1129655891 15:77525652-77525674 CAGCAGCCCACATGGACACATGG - Intergenic
1129996005 15:80006821-80006843 CTGCTGTGCTCCAGGACAAATGG - Intergenic
1131564341 15:93472357-93472379 CAGCAGTCATCACGGTCACATGG - Intergenic
1133261909 16:4556435-4556457 CAGGTGTCCTCAAGGACAAGGGG - Intergenic
1139493576 16:67300413-67300435 CAGCACTCCTCAAACACAAAGGG - Intronic
1141004329 16:80337998-80338020 CAGCTGTCCTCCAGGAAAAGTGG + Intergenic
1149526108 17:57357141-57357163 AGGCTGTCCTCAAGGAGAAACGG - Intronic
1149724425 17:58879006-58879028 CAAAAGTCCTGAATGACAAAAGG - Intronic
1151291235 17:73151597-73151619 CAGCAGACTTCAAGAACAACTGG + Intergenic
1156572679 18:38276751-38276773 CAGCAGTCCTAAGGGACATTTGG + Intergenic
1157686388 18:49646021-49646043 CAGCTCTCCCCAGGGACAAAGGG - Intergenic
1158642340 18:59214264-59214286 AAGGAGTCCTCAAGGACCAGAGG + Intergenic
1159769545 18:72532703-72532725 CAAAAGTCCTCTAGGATAAAGGG - Intergenic
1165804284 19:38571117-38571139 CAGGCCTCCTGAAGGACAAAGGG + Intronic
925659079 2:6183578-6183600 CTGAAGTCCTGAAGGATAAAGGG - Intergenic
927195816 2:20545944-20545966 CAGCAGTGAACAAGGACAGATGG + Intergenic
927467547 2:23348422-23348444 CAGCCGTCCCCCAGGACACAGGG - Intergenic
928804805 2:35138110-35138132 CAGCAGATCTTAATGACAAAAGG - Intergenic
929788965 2:45010162-45010184 CAGCGGTCCTCGAGGGAAAAGGG + Intergenic
931495741 2:62805027-62805049 CAGCTGTTCTAGAGGACAAATGG + Intronic
932307794 2:70716232-70716254 TAGCTGTCCTCAAGGAGAAGGGG - Intronic
932326486 2:70865491-70865513 CAGAAGCCCTCCAGCACAAAAGG + Intergenic
936173560 2:110198236-110198258 CAGCAGACATAAAGGACCAAAGG + Intronic
937253880 2:120541233-120541255 CGGCAGACAGCAAGGACAAAGGG - Intergenic
937919778 2:127120929-127120951 CAGCAGTCCTACAGAACAGAAGG - Intergenic
939054069 2:137341460-137341482 ATGCAGTCATCAAGAACAAAAGG - Intronic
940832630 2:158484396-158484418 CTTCAGTTCTCAAGGACAAGTGG - Intronic
941479473 2:165988452-165988474 CAGCAGACCTGAAGGAGCAAGGG + Intergenic
941836106 2:170022453-170022475 CACCAGTCAACAAGGACACATGG - Intronic
942088200 2:172462828-172462850 CAGCAGCGCTAAAGGACGAAGGG - Intronic
942541701 2:177021796-177021818 CAGCAGTCCTAAAGGAAACAGGG - Intergenic
944777525 2:202982145-202982167 CAGAAGTCCTGAAGGACTAGAGG - Exonic
946446133 2:219741250-219741272 CAAGAGTCATCAAGGAGAAAGGG - Intergenic
947906610 2:233768418-233768440 AAGCAGTCATCAATGACAAAAGG + Exonic
948895972 2:240927049-240927071 GAACAGTTCTCAAGGACAAAGGG - Intronic
1168969174 20:1919131-1919153 CTCCAGGCCTCAAGGATAAATGG + Intronic
1169545648 20:6648055-6648077 GAGCAGTCCTCAAGCAATAAAGG + Intergenic
1170320299 20:15089672-15089694 CAGCAGGACTCAAGGGCAAAGGG - Intronic
1170368255 20:15620090-15620112 AAGCAGTTCTCCAGGACAGAAGG + Intronic
1170763741 20:19273425-19273447 CAGAAGTCCTGATGGAGAAAGGG - Intronic
1172323236 20:34013681-34013703 CAGCAGTCCTAGAAGTCAAAGGG - Intronic
1173356152 20:42292642-42292664 CATCTGACCTCAATGACAAAGGG - Intronic
1175504042 20:59469581-59469603 CTGCAGTCCTCACAGAAAAATGG - Intergenic
1183446686 22:37861232-37861254 AAGCGGTCCTCAAGGAGAAGAGG - Intronic
1183594227 22:38800390-38800412 CAGCTGGCCTCAAGGACAACTGG - Intergenic
1184094958 22:42311458-42311480 CACCTTTCCTAAAGGACAAAAGG + Intronic
1184259857 22:43308576-43308598 CAGCTGTCTTCCAGGACAAGAGG + Intronic
950621776 3:14211763-14211785 CAGCAGTGCGCAGGGACAAAGGG + Intergenic
950732241 3:14970757-14970779 CAGCATTCCTCAAAGCCAAGAGG - Intronic
951862577 3:27270261-27270283 GAGCAGCCCTCAAGGATAAAAGG + Intronic
952344534 3:32471408-32471430 AAGAAGTCCTCAAGTTCAAAAGG - Intronic
953642229 3:44719425-44719447 CAGCATTATTCAAGGAAAAAGGG - Intronic
953822574 3:46221308-46221330 CTTAAGTCTTCAAGGACAAATGG + Intronic
955564262 3:60226769-60226791 CAGCACTTCTCAAGGCCATAGGG - Intronic
956702266 3:71968747-71968769 CAGAAGTGCTCAAGGATAATTGG - Intergenic
957522751 3:81341318-81341340 CAGCAGTACTAAAGAACTAATGG + Intergenic
958169707 3:89923173-89923195 CATCAGTTCTCTAGGACAATTGG + Intergenic
959247191 3:103887168-103887190 GAGCAATCCTCAAGAAAAAAAGG - Intergenic
962697245 3:137962426-137962448 CACCAGTCCTTGGGGACAAAAGG + Intergenic
963261319 3:143194069-143194091 CTTCAGTCTTCAAGGTCAAATGG + Intergenic
966621854 3:181973599-181973621 CCTCAGTCCTCAAGAACAAATGG + Intergenic
967049097 3:185765638-185765660 CAGAAGTGCTCGAGGACCAAGGG + Intronic
967965808 3:194959489-194959511 CAGCAGTGAGCAAGGCCAAATGG + Intergenic
968262409 3:197335721-197335743 CAGCAGTCCTCTATGGCAAGGGG + Intergenic
968785913 4:2622339-2622361 CAGGAGTCCCCAAGGGCAGAGGG + Intronic
969716358 4:8870192-8870214 CAGCTGGCCTCAAGGTCCAAAGG + Intronic
970658873 4:18262199-18262221 CAGTAGTCTTCAGGGACAAAAGG - Intergenic
971019252 4:22517096-22517118 CAGCTATCTTCAAGGACAAGAGG + Intergenic
972176240 4:36409910-36409932 CTGCAGAGCTCTAGGACAAAAGG - Intergenic
983554440 4:169047200-169047222 CTGAAGTCCACAAGGACAAGAGG + Intergenic
988693742 5:33598104-33598126 CAGATGTCATCAAGGGCAAAAGG + Intronic
991353926 5:65748219-65748241 CAGCAGTCATCCAGGTCGAAGGG + Intronic
993193413 5:84707233-84707255 CAGCAGTCCCTAGGGACACATGG + Intergenic
998267181 5:140674862-140674884 CTGCTGTCCTCAGGGACAGAGGG + Intronic
998685540 5:144520230-144520252 CAGTAGTCCTCCATGAAAAATGG - Intergenic
999626910 5:153530701-153530723 GGGCAGCCCTCAAGGACATAGGG - Intronic
1000101468 5:158021122-158021144 GTGCAGTCCTCAATGACAAATGG - Intergenic
1000140400 5:158397701-158397723 CAACAGTGTTCAAGGACAACTGG - Intergenic
1001198933 5:169698490-169698512 CAGCAGCCCTTGATGACAAAGGG - Intronic
1001366892 5:171150890-171150912 CAGTGTTCCTCAATGACAAAAGG - Intronic
1003212882 6:4082858-4082880 GAGAAGTACTCAAGTACAAAAGG - Intronic
1006716269 6:36122702-36122724 GAGCAGTCCTGAAGGACCAGAGG + Intergenic
1009983373 6:70752597-70752619 TAGCTGTCCTCAAGGACTCAAGG - Intronic
1010049250 6:71483719-71483741 CCCTAGGCCTCAAGGACAAAGGG - Intergenic
1011047884 6:83106856-83106878 AAGCAGTCCTGAAAGTCAAAAGG + Intronic
1013186530 6:107764276-107764298 AAGCAGGCCTCAAGGCCAAAAGG - Intronic
1013781448 6:113732891-113732913 CAGCAGTCCTGCTGGACACAGGG + Intergenic
1016987262 6:149904890-149904912 CAGGAGGCCCCAAGGACTAATGG + Intergenic
1018720727 6:166569846-166569868 CAGCAGTCCTGAAGGACGAGGGG - Intronic
1018734084 6:166674480-166674502 CAGCAGGCACCAAGGACAAGAGG + Intronic
1019301964 7:309900-309922 CCCAAGTCCTCAAGGACAAAGGG + Intergenic
1019701995 7:2478514-2478536 CAGCAGGCTTCGAGGCCAAAAGG + Intergenic
1019779399 7:2930600-2930622 CACCAGTCCTCAGAGACACATGG - Intronic
1020477028 7:8608252-8608274 CAGCTGTTCTCAGGGATAAATGG + Intronic
1022604532 7:31797133-31797155 CAGGAGTTTTCATGGACAAATGG + Intronic
1023746691 7:43328930-43328952 CAGCAGGCCTCCAGCACAATAGG - Intronic
1025172452 7:56771858-56771880 CAGCAGTCAGCCAGGGCAAATGG + Intergenic
1025831436 7:65054642-65054664 CAGCAGTCAGCCAGGGCAAATGG - Intergenic
1025918574 7:65888533-65888555 CAGCAGTCAGCCAGGGCAAATGG - Intronic
1030542177 7:110844707-110844729 CAGCAGTCCAGAAGGAGAGATGG + Intronic
1032649393 7:133861084-133861106 AAGCAGTCCTCAAGTCAAAAAGG + Intronic
1034654483 7:152718519-152718541 AACCAATCCTCAAGCACAAATGG - Intergenic
1035134613 7:156689239-156689261 CAACATTCTTCAAGGAAAAAAGG + Intronic
1035611707 8:970435-970457 CACCAGTGCTTAAGGACAAATGG + Intergenic
1036293306 8:7514789-7514811 CAGCAGTATTGAAGGACAATGGG - Intergenic
1038466217 8:27766293-27766315 CTGGAGCCCTGAAGGACAAAGGG + Intronic
1043598023 8:81906413-81906435 CAGCAATCCTCATGTACTAAAGG + Intergenic
1044379202 8:91513648-91513670 CAGCAGACTTAAAGTACAAAGGG + Intergenic
1046608314 8:116395214-116395236 AACCACTGCTCAAGGACAAATGG + Intergenic
1048742843 8:137581102-137581124 CAGCAGGCCTCAGGGAGAAACGG + Intergenic
1049385100 8:142339162-142339184 TAGGGGTCCTCAAGGAGAAACGG + Intronic
1053366037 9:37523225-37523247 CATCAGTCCTCAAGGCCATTGGG - Intronic
1057540119 9:95959823-95959845 AAGGAGTCCTAAAAGACAAAAGG + Intronic
1058579437 9:106439203-106439225 CAGATGTCATCAAGGACAATAGG + Intergenic
1059122951 9:111659061-111659083 CAGCCTTCCTCAAGTACAAGTGG + Intronic
1059256504 9:112935865-112935887 CAGCAGCTCTAAAAGACAAAAGG + Intergenic
1060193915 9:121610702-121610724 CAGCACTACTCAAGGACAGTGGG - Intronic
1061658646 9:132112735-132112757 TAGCAATCAACAAGGACAAATGG + Intergenic
1187274381 X:17805389-17805411 CTGCAGTCCCCAAGGACAGGAGG - Intronic
1190689098 X:52898815-52898837 CAGCAGACCTCAGTGAGAAATGG + Intronic
1190696885 X:52956977-52956999 CAGCAGACCTCAGTGAGAAATGG - Intronic
1191170879 X:57445899-57445921 CATCAGACCTCAAGGACTACAGG - Intronic
1196400509 X:115311667-115311689 CAGCATTCTCCAAGGACACAGGG + Intergenic
1196793702 X:119486141-119486163 CTGCAACCCTCAAGGACAATTGG + Intergenic
1198379281 X:136068916-136068938 CAGCAATCCTCAAGTGGAAATGG - Intergenic
1199287295 X:146067849-146067871 CAGTAGTCTTTAAGAACAAATGG + Intergenic
1199660607 X:150046660-150046682 CAGGAGTTCACAAGGAAAAACGG - Intergenic
1200048744 X:153417127-153417149 CAGCAGTTCTCAATGCCAGATGG - Intergenic