ID: 1075729599

View in Genome Browser
Species Human (GRCh38)
Location 10:124628378-124628400
Sequence AATACCGCAGCCTCCTTCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 39
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 36}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075729599_1075729611 16 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729611 10:124628417-124628439 TGGCTCTCCACTGAACCTGGAGG No data
1075729599_1075729602 -10 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729602 10:124628391-124628413 CTGCGGTATTCTCACCCCCTGGG No data
1075729599_1075729603 -4 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729603 10:124628397-124628419 TATTCTCACCCCCTGGGCCCTGG No data
1075729599_1075729614 23 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729614 10:124628424-124628446 CCACTGAACCTGGAGGGTTCCGG No data
1075729599_1075729609 13 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729609 10:124628414-124628436 CCCTGGCTCTCCACTGAACCTGG No data
1075729599_1075729612 17 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729612 10:124628418-124628440 GGCTCTCCACTGAACCTGGAGGG No data
1075729599_1075729615 28 Left 1075729599 10:124628378-124628400 CCTCCGAAGGAGGCTGCGGTATT 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1075729615 10:124628429-124628451 GAACCTGGAGGGTTCCGGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075729599 Original CRISPR AATACCGCAGCCTCCTTCGG AGG (reversed) Intronic
912654183 1:111470859-111470881 AATACCGCTGTTTCCTTCTGTGG + Intergenic
1075729599 10:124628378-124628400 AATACCGCAGCCTCCTTCGGAGG - Intronic
1083186019 11:61018353-61018375 ACCACCCCAGCCCCCTTCGGAGG + Exonic
1089749988 11:120644580-120644602 AATATCGCTGCCTCTTTCCGTGG + Intronic
1090417368 11:126549791-126549813 AAAACTGCAGCCTCCTGGGGTGG + Intronic
1096491438 12:52015117-52015139 AGTACCGCAGCTTCCGCCGGCGG + Exonic
1096532139 12:52248886-52248908 AATAAAGCAGCCTCATTCTGAGG + Exonic
1101509065 12:105376356-105376378 AATACTGCAGACTCCTTAGAAGG + Intronic
1105360671 13:19711730-19711752 CCTACCGCAGCCTCCTGAGGAGG - Intronic
1113314786 13:109167129-109167151 AAGACTGCAGCCTCCATCTGGGG - Intronic
1127788762 15:62379713-62379735 CCCACCTCAGCCTCCTTCGGAGG - Intergenic
1128239959 15:66095143-66095165 AATGCTGCAGCCTCCTGAGGTGG + Intronic
1129824899 15:78628539-78628561 AATACCTCAGCCTCCTTCCAGGG + Intronic
1143781800 17:9233090-9233112 ACCACCTCAGCCTCCTTCGGAGG + Intronic
1146640444 17:34536686-34536708 AATATCCCAGCCTCCTCTGGTGG - Intergenic
1163686871 19:18716768-18716790 AATACAGAAGCCTCCTACTGGGG - Intronic
941504636 2:166327099-166327121 ATTACAGCTGCCTCCTTCTGTGG - Intronic
1168893127 20:1307181-1307203 AATACCCCACCCTCCTCCAGAGG - Exonic
1170119083 20:12892885-12892907 AATACTGCAGCCTCAGCCGGTGG - Intergenic
1171080702 20:22180425-22180447 AATACCCCAGCCTCCTCTAGGGG + Intergenic
1179930805 21:44569788-44569810 CACACAGCAGCCTCCATCGGGGG - Intronic
962807216 3:138936346-138936368 ATTACCACCGCCTCCCTCGGCGG - Intergenic
967712041 3:192720391-192720413 AATACCACGGCCTCCCTGGGTGG + Intronic
977861550 4:101966862-101966884 TATTCAGCAGCCTCCTTGGGTGG - Intronic
985571202 5:646491-646513 GATAGGGCAGCCTCCTTCTGGGG + Intronic
997303860 5:132824792-132824814 ATCACCGCAGCCTCTTTCTGAGG + Exonic
1006455747 6:34130889-34130911 AATACAGCAGCCTCCCTTGTGGG + Intronic
1006459954 6:34152490-34152512 AATGCTGCTGCCTCCTTCGAGGG - Intronic
1014680215 6:124419506-124419528 AATTCAGCAGCCTCCTTCTTAGG - Intronic
1040743564 8:50611674-50611696 ACTACCTCAGCCTCCTTAAGTGG - Intronic
1040768300 8:50943108-50943130 AATCCTGCAGCTTCCTTCTGTGG + Intergenic
1048415699 8:134225571-134225593 AATAGAGCAGCATCCTTCGTGGG - Intergenic
1049194220 8:141307055-141307077 AACACCTCAGGCTCCTTAGGAGG + Intronic
1049394987 8:142395829-142395851 AACACAGCAGCCTCCTTCCTGGG - Intronic
1058721433 9:107768239-107768261 AATGCAGCAGCCTCCTGCTGCGG - Intergenic
1061635429 9:131905420-131905442 AAAACAGCAGCTTCCTTGGGTGG - Intronic
1062046929 9:134428630-134428652 AGAGCCGCAGCCTCTTTCGGGGG - Intronic
1062452011 9:136619770-136619792 AGCACCGCAGCCTCCTCTGGGGG - Intergenic
1194598682 X:95892443-95892465 AATACCACAGGATCCTTAGGAGG + Intergenic