ID: 1075730066

View in Genome Browser
Species Human (GRCh38)
Location 10:124630720-124630742
Sequence GTAAATATCTTCAGGGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075730053_1075730066 18 Left 1075730053 10:124630679-124630701 CCAGACCACAGGTTCTAGAAGCA 0: 1
1: 0
2: 3
3: 39
4: 182
Right 1075730066 10:124630720-124630742 GTAAATATCTTCAGGGTGGAAGG No data
1075730054_1075730066 13 Left 1075730054 10:124630684-124630706 CCACAGGTTCTAGAAGCAAATGG No data
Right 1075730066 10:124630720-124630742 GTAAATATCTTCAGGGTGGAAGG No data
1075730061_1075730066 -10 Left 1075730061 10:124630707-124630729 CCCAGTGGGGGTGGTAAATATCT 0: 1
1: 0
2: 1
3: 14
4: 104
Right 1075730066 10:124630720-124630742 GTAAATATCTTCAGGGTGGAAGG No data
1075730052_1075730066 19 Left 1075730052 10:124630678-124630700 CCCAGACCACAGGTTCTAGAAGC 0: 1
1: 0
2: 2
3: 40
4: 180
Right 1075730066 10:124630720-124630742 GTAAATATCTTCAGGGTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075730066 Original CRISPR GTAAATATCTTCAGGGTGGA AGG Intronic
No off target data available for this crispr