ID: 1075731967

View in Genome Browser
Species Human (GRCh38)
Location 10:124641713-124641735
Sequence CCTCTCTGGCTCCCAAGGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 300}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075731967_1075731980 19 Left 1075731967 10:124641713-124641735 CCCTTCCTTGGGAGCCAGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1075731980 10:124641755-124641777 CCTCGGTCCCAGGTGTCAACAGG No data
1075731967_1075731982 23 Left 1075731967 10:124641713-124641735 CCCTTCCTTGGGAGCCAGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1075731982 10:124641759-124641781 GGTCCCAGGTGTCAACAGGTGGG No data
1075731967_1075731981 22 Left 1075731967 10:124641713-124641735 CCCTTCCTTGGGAGCCAGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1075731981 10:124641758-124641780 CGGTCCCAGGTGTCAACAGGTGG No data
1075731967_1075731977 9 Left 1075731967 10:124641713-124641735 CCCTTCCTTGGGAGCCAGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1075731977 10:124641745-124641767 CCTTCTTGACCCTCGGTCCCAGG No data
1075731967_1075731973 2 Left 1075731967 10:124641713-124641735 CCCTTCCTTGGGAGCCAGAGAGG 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1075731973 10:124641738-124641760 AGGAGCCCCTTCTTGACCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075731967 Original CRISPR CCTCTCTGGCTCCCAAGGAA GGG (reversed) Intronic
900174665 1:1286447-1286469 CCTCTCGGACTGCCAAGGAGGGG + Intronic
900228908 1:1546068-1546090 CCTCAGGGGTTCCCAAGGAAGGG + Intronic
900577750 1:3392106-3392128 CCTCTCTCTCTCCCAAGGCCAGG + Intronic
901202368 1:7473883-7473905 TGCCTCTGGCTCCCCAGGAAGGG + Intronic
902194865 1:14790990-14791012 CCCCGCTGGCTTCCAAGGGAGGG + Intronic
903275926 1:22221760-22221782 CCTCAATGGCTCCCAAGCACTGG + Intergenic
903930067 1:26856884-26856906 GCTCTCTGCCTCTCCAGGAATGG + Exonic
904301583 1:29557794-29557816 CCTCTCTGGGCCCTAAGGAGTGG - Intergenic
905003018 1:34688327-34688349 CCTGTCTGTCTCCAAGGGAAAGG + Intergenic
905906428 1:41621417-41621439 CCCCTCTGTCTCCCAAGGGAGGG + Intronic
906762463 1:48388068-48388090 CCACTCTGGAGCCCAAGGACAGG + Intronic
906776129 1:48531212-48531234 TCTCTCTCTCTCTCAAGGAATGG + Intergenic
907419225 1:54335699-54335721 CCTCCCTGGCTCCTGAGGACAGG - Intronic
907685314 1:56605686-56605708 AATCTCTGACCCCCAAGGAAAGG + Intronic
907926477 1:58959213-58959235 CCTCTCCTCCTCCAAAGGAACGG + Intergenic
907930554 1:58995336-58995358 CCTTTCTGGCTCATAAGGACTGG - Intergenic
907986269 1:59533923-59533945 CCTCTCCTCCTCCAAAGGAACGG + Intronic
909587533 1:77307735-77307757 CCTCTCTGGGTGCCAGGGGAGGG - Intronic
909803604 1:79846748-79846770 CCACTATGGGTCCCAAGGCAGGG - Intergenic
910557640 1:88553636-88553658 CTTCTCTGTCTACCAAGCAATGG - Intergenic
911629316 1:100164821-100164843 CCCCTCTGCCTCCCAAGTAACGG + Intronic
912804466 1:112744264-112744286 CCTCTCTCGCTCCCAGGGCCTGG + Intergenic
912823799 1:112887583-112887605 CCTATCTGCCTCCAAAGGACAGG - Intergenic
916006250 1:160663903-160663925 CATCTCAGGCTCCCAAGTAGTGG - Intergenic
916173506 1:162019685-162019707 CCTCTCTGGCTCCATAAGGAGGG + Intronic
916352563 1:163868050-163868072 CCTCCTTGGCTCCCATAGAAGGG - Intergenic
917597629 1:176545105-176545127 CCTCTTTGACTTCCAAGGAGGGG - Intronic
918447360 1:184628726-184628748 CCTCTCTGGGTCTCCAGAAAAGG + Exonic
919834667 1:201565566-201565588 CCTCTCTGCCCTCCAAAGAAGGG - Intergenic
919845405 1:201639299-201639321 CCTCGCTGGCTTCCCAGGAAAGG - Intronic
920919258 1:210284653-210284675 CATCTCTGTCTCTCAAGAAACGG + Intergenic
920973103 1:210759285-210759307 CCCCACTAGCTCCCAAGCAATGG + Intronic
920987733 1:210906294-210906316 CATGTCTGGCTGCCAGGGAATGG + Intronic
922242250 1:223763359-223763381 CCTCCCAGATTCCCAAGGAAAGG + Intronic
923870825 1:237992434-237992456 GCTCCCTGGATCACAAGGAAGGG - Intergenic
924003937 1:239586099-239586121 CCTGTCTGCCTCCCACGGGAGGG - Intronic
1062833709 10:623100-623122 CCTCACTGGCTCCCTGGGAAGGG - Intronic
1062913033 10:1226458-1226480 CCTCTCCTCCTCCAAAGGAATGG - Intronic
1067493995 10:46746017-46746039 TCTCACTAGCTCCCTAGGAAAGG - Intergenic
1067532059 10:47081141-47081163 CCTCTCTGACTCCCAAGCGAGGG - Intergenic
1067564641 10:47327685-47327707 CCCCTCTGCCTCCTTAGGAAGGG - Intergenic
1067600667 10:47594387-47594409 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1067955917 10:50790311-50790333 CATCTCTGGGTCCCCAGGGAAGG - Intronic
1069368921 10:67723403-67723425 CATCTCTGCCTCCCAAGTAGTGG + Intergenic
1069720297 10:70545348-70545370 CCTCTCTGGCCACCAGGGAGAGG + Intronic
1070153916 10:73821764-73821786 CTCCTCTGGCTTCCAAGGGATGG - Intronic
1070847486 10:79535289-79535311 CCTCTAAGGATCCCAAGGAAGGG - Intergenic
1070926300 10:80224851-80224873 CCTCTAAGGATCCCAAGGAAGGG + Intergenic
1071652200 10:87402259-87402281 TCTCACTAGCTCCCTAGGAAAGG + Intergenic
1072438020 10:95431150-95431172 CCTCTCTGGTCCCAAGGGAATGG + Intronic
1074050470 10:109876905-109876927 CCCCTCTGTCTCACAAGGAAGGG + Intronic
1074204192 10:111267850-111267872 CCTCTATGGCTTCAACGGAAGGG - Intergenic
1074945779 10:118279214-118279236 CCTCTCTCCCTCCCCAGGGAGGG + Intergenic
1075228653 10:120651997-120652019 ACTCCCTAGCTCCTAAGGAATGG + Intergenic
1075731967 10:124641713-124641735 CCTCTCTGGCTCCCAAGGAAGGG - Intronic
1076252975 10:128997621-128997643 CCTCTCTGAGTCCCTAAGAAAGG - Intergenic
1076322179 10:129591386-129591408 GCCCTCTGTCTCCCCAGGAAAGG + Intronic
1077522052 11:3042250-3042272 TCTCTCTGCCTCCCAGGCAAAGG - Exonic
1078082094 11:8211494-8211516 CTGTTCTGGCTCCCAAGGCATGG - Intergenic
1078545468 11:12243824-12243846 CCTTTCTGGCTCCAAAGACAGGG + Intronic
1080094920 11:28394465-28394487 ACACTCTGGCTCACAAGGAGGGG + Intergenic
1081274045 11:41124800-41124822 CCACTCTGGCTCCTAAAGAATGG - Intronic
1081593590 11:44444192-44444214 CCTCTCAGGCACCCATGGCACGG - Intergenic
1082596261 11:55085454-55085476 CCTCTCCTCCTCCAAAGGAATGG + Intergenic
1084092306 11:66886638-66886660 CCTCTCTGCCTCCCATCTAATGG - Intronic
1084620172 11:70264523-70264545 CCTCTCAGCCTCCCAAGTACTGG + Intergenic
1084968435 11:72756434-72756456 CCTCTCTGGGTCCCCAGGGCTGG - Intronic
1085022231 11:73217155-73217177 CCTTTGTGTCTCCCAAGCAAAGG + Intergenic
1085032902 11:73283446-73283468 CCTCTCTGGCTTCCAGGAAAGGG - Intronic
1085408472 11:76277875-76277897 CCTCTCTGGCTCGCATGGGTGGG + Intergenic
1085450512 11:76629440-76629462 CTTCTCTGGCTCCCATGGCCTGG - Intergenic
1087012818 11:93529634-93529656 CCTTTTTGCCTCCAAAGGAAGGG - Intronic
1088242964 11:107789894-107789916 CCTCAGTGGATTCCAAGGAATGG - Intergenic
1088870542 11:113886760-113886782 CATCTCTATCTCCCAAGGGATGG - Intergenic
1089090327 11:115869431-115869453 CCACCCTGGATCCCAAGGACAGG - Intergenic
1090346403 11:126075186-126075208 TCTCTCTGGCCCCCAGGGAAAGG - Intergenic
1091297031 11:134481249-134481271 TCTCTCTGCCTCCTAATGAAAGG - Intergenic
1091348821 11:134876430-134876452 CCGTTCTGGTTTCCAAGGAAAGG - Intergenic
1091746293 12:2995126-2995148 CCTCCTGGGCTCCCAAGGGATGG + Intronic
1092714862 12:11378245-11378267 CCTCTCCTCCTCCAAAGGAATGG + Intronic
1092767547 12:11866875-11866897 CCTCTGTGGCTCCCACTGTATGG + Intronic
1092817129 12:12322159-12322181 CCCCTCTGCCTTCCAAGGCATGG - Intergenic
1092985140 12:13837896-13837918 CCTCCCTGCCTCCCTAGGAGCGG + Intronic
1095180122 12:39137795-39137817 TCTCTCTAGCTCCCAATGTAGGG + Intergenic
1096667383 12:53174979-53175001 CCCCGCTGGCTCTCAGGGAAGGG + Intronic
1099904353 12:88754294-88754316 CCCCTCTAGCTCACAAGGAAAGG + Intergenic
1101991292 12:109487460-109487482 CCTCTTTGGCTGCTCAGGAATGG + Intronic
1103530425 12:121597373-121597395 CCTCTCTGGCTCCCGAAGTGCGG + Intergenic
1104089531 12:125503611-125503633 ACTATCTGGATTCCAAGGAAAGG - Intronic
1106719764 13:32426422-32426444 CCTCTCTGGCTCGCTGGGGAGGG - Intronic
1108903099 13:55436662-55436684 CCTCACTAGTTCCCAAGTAATGG + Intergenic
1111021485 13:82457947-82457969 CCTCACAGGATTCCAAGGAATGG - Intergenic
1111501999 13:89133687-89133709 ACTCTCTGGTGCCCAAGGTAAGG + Intergenic
1111721941 13:91956554-91956576 CCATCCTGGATCCCAAGGAAAGG + Intronic
1112051052 13:95644207-95644229 CCTGTTTGCCTTCCAAGGAAGGG - Intronic
1112310061 13:98310252-98310274 CCTCTGTGCCTCCCCAGGAATGG + Intronic
1112467904 13:99659997-99660019 CCTCTCTGTCTCCACAGGCAAGG - Intronic
1113632953 13:111900338-111900360 CCTCTCGGCCCCCCAGGGAATGG - Intergenic
1114425667 14:22620683-22620705 CCTCTCCTCCTCCAAAGGAATGG - Intergenic
1118744411 14:68763334-68763356 CCTCCCTGGCTCCCTAGGGATGG + Intergenic
1119018637 14:71085792-71085814 CCTGTGTGGCTCCTAAGGATGGG - Intronic
1119616966 14:76105142-76105164 CCTCTCTGCCTCACCAGGGAGGG - Intergenic
1119732121 14:76957575-76957597 CTTTTCTGGCAGCCAAGGAAAGG - Intergenic
1119732914 14:76962489-76962511 CCTCCCTGGCTCCCCAGGGCTGG - Intergenic
1119768958 14:77208388-77208410 AGTCTCTGGCTCCCAGGGAGGGG - Intronic
1121452039 14:94014890-94014912 CATCACTGGCTCCCGGGGAATGG - Intergenic
1123012456 14:105356045-105356067 CATCTCCGGCTCCCAATGAGGGG - Intronic
1123047429 14:105525957-105525979 CTTCTCTGGCTCACACGGGATGG + Intergenic
1123903932 15:24903782-24903804 CCTCTCTGCCTCCAAAGTGATGG - Intronic
1125578081 15:40768430-40768452 CCTCTTAGGTTCCCAAGGAAGGG + Intronic
1127685085 15:61335685-61335707 CCTCTCTAGCTGCCAAAGCAAGG + Intergenic
1128616789 15:69116576-69116598 TCTCTCTGCCTCCTTAGGAAGGG - Intergenic
1128944864 15:71813295-71813317 CATCTCAGGCACCCAAGGAATGG - Intronic
1129094061 15:73183775-73183797 ACTCTCTGGCTCCTAAGCACAGG + Intronic
1130273028 15:82462235-82462257 CCACCCTGGCTCCCAAGGCTTGG + Intergenic
1130487311 15:84405214-84405236 CCACCCTGGCTCCCAAGGCTTGG - Intergenic
1130587669 15:85194201-85194223 CCACCCTGGCTCCCAAGGCTTGG + Intergenic
1131691735 15:94834677-94834699 TCTCTCTGTGCCCCAAGGAAAGG + Intergenic
1131841331 15:96441065-96441087 CCTCTCTGACCCCAGAGGAACGG - Intergenic
1131970420 15:97886942-97886964 TCTCTCTGTCTCCCAAAGAAGGG - Intergenic
1132128260 15:99249663-99249685 CACCTCTGGCTCCCAAAGATTGG - Intronic
1132378071 15:101345080-101345102 CCTCAGGGGCACCCAAGGAAAGG - Intronic
1132641785 16:981529-981551 CCTCTCTGGAGCCCCGGGAAAGG - Intergenic
1132768442 16:1547052-1547074 CCTCTCTGGCACCAAAACAAGGG - Intronic
1133333604 16:4991822-4991844 TCTCTCTGGCTTCCAGGGGAAGG + Exonic
1134843928 16:17424008-17424030 CATCTCTGCCTCCCAAGAAGGGG + Intronic
1136247948 16:28985907-28985929 TCTCCCTGGCACCCAAGGTAGGG - Intronic
1138553069 16:57757698-57757720 CCCCTCCTGCTCCCAAGGCAGGG + Intergenic
1138891398 16:61148791-61148813 CCTCGCTAGCTCCCCAGCAATGG - Intergenic
1139309367 16:66015348-66015370 CCTCTCAGGCACACATGGAATGG + Intergenic
1141163610 16:81645606-81645628 CCTCTCTGCTTGTCAAGGAAGGG - Intronic
1141798087 16:86287923-86287945 CTTCTCTTGCTCCCCAGGGAGGG - Intergenic
1142509129 17:383779-383801 TCTCTCTGGCTCTCCAGGACTGG - Intronic
1142717088 17:1753062-1753084 CCTCGCTGGCTTCCCTGGAAGGG + Intronic
1143023691 17:3929238-3929260 CCTCTCTGGCCCCCCTGCAATGG - Intronic
1143510008 17:7390212-7390234 CCCCTGTGGTTCCCAAGGAGGGG - Exonic
1143837537 17:9703912-9703934 CCTCAGTGGCTTCCTAGGAAAGG + Intronic
1147164238 17:38585041-38585063 CCTCTCAGGTCCCCAAGGGAGGG - Intronic
1147615096 17:41822859-41822881 CCTGACTGGCTCCTAGGGAAGGG + Exonic
1150606518 17:66696041-66696063 CACCTCTTGCTCCCCAGGAAGGG - Intronic
1151213954 17:72564678-72564700 CCTCCCTGGGGCTCAAGGAACGG + Intergenic
1151819485 17:76489958-76489980 CCTCTCTGGCTCCCTGAGAGGGG - Intronic
1152459445 17:80433524-80433546 CCTGTCTGGCTCCAGAGGAAGGG - Intronic
1152643972 17:81460447-81460469 CCAGACGGGCTCCCAAGGAAGGG + Intronic
1152815745 17:82406723-82406745 ACCCTCTGCCTCCCAAGTAAAGG + Intronic
1153828874 18:8901802-8901824 CCACACTGGCTCCCCAGCAAGGG + Intergenic
1156135567 18:34032788-34032810 CCACTCTGGGACCCAAGGACAGG + Intronic
1156514101 18:37665492-37665514 TCTTCCTGGCTCCCAAGGGAGGG - Intergenic
1157278820 18:46332659-46332681 CCTCTCTGGCCTCCAAGAATTGG + Intronic
1158735722 18:60076080-60076102 CCACTGTGGGGCCCAAGGAAAGG + Intergenic
1158821080 18:61159477-61159499 CTTCTCTGTCTCCATAGGAATGG + Intergenic
1163105934 19:15123089-15123111 CCCCACTGGCCCCCAAGGACTGG + Intronic
1164513845 19:28917848-28917870 CCTCTCTGGCTCTCTTGGGACGG + Intergenic
1164884646 19:31768165-31768187 CCTCTCTGCCTCCCAAAGATTGG + Intergenic
1164905178 19:31961324-31961346 CCTGTCTGGCTGCCATGGCATGG - Intergenic
1165590160 19:36962052-36962074 CCTCTCTGGCTCCAAAGTGCTGG + Intronic
1166123475 19:40699859-40699881 ACGCTCTGCTTCCCAAGGAAAGG - Intronic
1166473866 19:43103780-43103802 CCACTCTGGGTCACAATGAAAGG - Intronic
1166684753 19:44789776-44789798 CCCCTCAGACTCCCAAGGTAGGG - Intronic
1166714614 19:44958833-44958855 CCTCTGTGGCTGCCTAGGATTGG - Intronic
1167861301 19:52285984-52286006 CCTCCCTGGATACCAAGGGAGGG + Intronic
1168723294 19:58566861-58566883 CCTCTCTGGCTGCAAAGAAAAGG + Intronic
925208396 2:2026584-2026606 CCTCGCTGGCTTCCTAGGACAGG + Intronic
928620613 2:33084310-33084332 CCTCCCTGTCTCCCCAAGAAAGG - Intronic
929735883 2:44548749-44548771 CCTCTCTGGCTGGCAAACAAGGG - Intronic
931106917 2:59066867-59066889 CCTCTCTGTCTCCCAGAGAGGGG - Intergenic
931491587 2:62754042-62754064 CCTCTCCCCCTCCAAAGGAACGG - Intronic
933406519 2:81866849-81866871 CCTCTCAGGCTCCCATTCAAGGG - Intergenic
933728366 2:85438782-85438804 CCTCTCTTTCTCCCCAGGGAGGG - Intergenic
936156284 2:110049507-110049529 CCTTGCTCCCTCCCAAGGAAAGG + Intergenic
936188405 2:110321935-110321957 CCTTGCTCCCTCCCAAGGAAAGG - Intergenic
936268507 2:111030112-111030134 CTTCTCTGCCTCCCATGCAATGG + Intronic
937236486 2:120434522-120434544 CCTGGCTGGCTCCCGGGGAATGG - Intergenic
937391223 2:121488360-121488382 CCTCACTGGCTCCTCAGCAAAGG + Intronic
937498578 2:122451596-122451618 TCTCACTAGCTCCCAAGCAATGG + Intergenic
937621868 2:123997783-123997805 CCTCTCAGTCTACCAAGGGAGGG - Intergenic
937974875 2:127576587-127576609 CCTCCCAGGCTCCCGAGGAGCGG + Exonic
939950634 2:148468580-148468602 CCTCCATGGCTGCCACGGAATGG - Exonic
941784109 2:169479478-169479500 TCTCTCTGGCTCCAAGGCAACGG - Exonic
942613151 2:177762711-177762733 CCGCTCTTCCTCCCAGGGAAAGG + Intronic
943032188 2:182698942-182698964 GACCTCTAGCTCCCAAGGAATGG + Intergenic
943374114 2:187054218-187054240 GCTCTCTTGCTCTCTAGGAATGG - Intergenic
944260107 2:197667843-197667865 CCTCACTGGGTCCCAAAGACAGG - Intronic
944639453 2:201708202-201708224 CCTGTCTAGTTACCAAGGAATGG + Intronic
944667932 2:201972329-201972351 CCTCCCTGCCTCCCAGGGACAGG - Intergenic
946257719 2:218458321-218458343 CATCTCTGCCTCCCAAAGTATGG - Intronic
946770083 2:223080130-223080152 CCTCTCTGACTTCTAAGGAATGG + Intronic
948072333 2:235138010-235138032 CCTCTCTGTCTCCCCAGGCCAGG + Intergenic
948655779 2:239475957-239475979 ACTCTCTGGCTGCCAGGGAGGGG - Intergenic
948862261 2:240758324-240758346 TCTCTCTCTCTGCCAAGGAAGGG + Intronic
1170045819 20:12084445-12084467 CCACTCAGGCTACCGAGGAAAGG - Intergenic
1171104957 20:22424019-22424041 CCTCTCTGTTTCCCCAGGAAAGG + Intergenic
1172094228 20:32452833-32452855 CCTCCCTGGCTGCCCAGGAGCGG + Intronic
1172393416 20:34581957-34581979 CCTCTGTGGCTCCTAGGGGAAGG - Intronic
1173120514 20:40284975-40284997 ACTCTCTTGCTCCCAAAGTAAGG + Intergenic
1175132006 20:56796369-56796391 CCCCTCTGACTCCCAGGGGAAGG + Intergenic
1177909441 21:27012484-27012506 CATCTCTGCCTCCCAAGTAGCGG - Intergenic
1179040195 21:37796023-37796045 CCCCTCAGGCTCCCATAGAACGG - Intronic
1179109556 21:38434458-38434480 CCTCTCTGGCGGCCCAGGAAAGG - Intronic
1181698695 22:24608029-24608051 CCCATCAGGGTCCCAAGGAAGGG + Intronic
1182021975 22:27089088-27089110 CCTCTCTCCATGCCAAGGAAAGG + Intergenic
1184817054 22:46880534-46880556 CATCTCCGTCTCCCAAGCAAAGG - Intronic
1185155952 22:49193675-49193697 CCTCTCTGGCTCGGACGGCAGGG - Intergenic
949254059 3:2023983-2024005 ACTTTCTGCCTTCCAAGGAAGGG - Intergenic
949563757 3:5226593-5226615 CTTTTCCTGCTCCCAAGGAAAGG + Intergenic
950462596 3:13134342-13134364 CCTCTCTGGCTCCCACTGTATGG - Intergenic
951157704 3:19375655-19375677 CCTCTCCTCCTCCAAAGGAACGG - Intronic
952080989 3:29757049-29757071 CCTCTCTGACTTCCAAGAACTGG - Intronic
953116281 3:39995130-39995152 CCTCTCCTCCTCCAAAGGAACGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
953498247 3:43407446-43407468 CTTCTCTGACTCCCAGGGACAGG + Intronic
954371837 3:50173012-50173034 AGTCTCTGGGTCCCAATGAAAGG - Intronic
954539029 3:51381640-51381662 CCTCTCTGGCTCCCTGGGGTGGG - Exonic
954845225 3:53550105-53550127 CCACGTTGGCTCCCATGGAAAGG + Intronic
955147434 3:56334136-56334158 TTTCTCTGTCTCCAAAGGAAAGG - Intronic
955751018 3:62185514-62185536 GCTCTCTGGCCCCCAAGGCGAGG - Intronic
958443313 3:94182749-94182771 CCTTCCTTTCTCCCAAGGAAAGG + Intergenic
958878151 3:99638615-99638637 GCTCGCTGGCTCCCACGGAGAGG - Exonic
960938555 3:122918709-122918731 CCCCTCAGGCTGCCAGGGAAGGG - Intronic
961509638 3:127392951-127392973 CATCTCTGGGTCCCCAGGAGTGG - Intergenic
961545217 3:127628881-127628903 CCACTCTGCTTCCCAGGGAACGG + Intergenic
962150474 3:132887571-132887593 CCTCTCTAGTTACCAATGAAAGG + Intergenic
962321302 3:134392851-134392873 CCACTCTGGCTGCCCAGGGATGG - Intergenic
962918857 3:139933990-139934012 CCTCTCTGGCTCCCCAAGCAGGG + Intergenic
963032133 3:140988645-140988667 CCTCTCCCCCTCCAAAGGAATGG + Intergenic
963642729 3:147879197-147879219 CCTCACTGGAACCCAAAGAATGG - Intergenic
964901927 3:161670649-161670671 CCACTCTGGGGCCCAAGGACAGG - Intergenic
966057420 3:175712560-175712582 CCTCTCTGGCCCAGCAGGAAGGG + Intronic
967721545 3:192821311-192821333 GCTCTCTGACTCCAAAGGTAGGG + Intronic
969666455 4:8560213-8560235 CCTCCCTCGCTCCCATGGACAGG + Intronic
970271079 4:14348309-14348331 CCCCTCTGTCTACCAAGGAATGG - Intergenic
971110535 4:23580365-23580387 CCTCCCTGGCTCCAAAGTGAGGG - Intergenic
971451711 4:26807079-26807101 ACTCTCTGACTCCCATGAAAAGG + Intergenic
972109600 4:35541356-35541378 CCTCCCTGGATCCCACTGAAAGG + Intergenic
975745960 4:77474048-77474070 TCTCGCTAGCTCCCAAGCAACGG + Intergenic
975929377 4:79500036-79500058 CTTCACTGGCACACAAGGAATGG - Intergenic
976948582 4:90799931-90799953 CCCCAGTGGCTCCCAGGGAATGG - Intronic
980866849 4:138562139-138562161 CCTGGCTGCCTGCCAAGGAAGGG + Intergenic
981093727 4:140757739-140757761 CCGCTTGGGCTCTCAAGGAATGG + Intergenic
981315808 4:143338034-143338056 CCACTCTGGTTCCCTGGGAAAGG - Intronic
982721968 4:158868874-158868896 CCTCACTGGCCTCCAAGGAGGGG - Exonic
983579264 4:169291690-169291712 TCTCTCTGGCCCTCAAGGAGTGG - Intergenic
984280392 4:177663309-177663331 CCTCTCAGGGTCCCTGGGAAGGG - Intergenic
984942106 4:184941885-184941907 CCTCACTGCCCCCCAAGCAAGGG - Intergenic
985893933 5:2738394-2738416 TCTCCCTGGCTCTCAAGCAATGG - Intergenic
986513590 5:8535638-8535660 CCTCTCTGTCACCCCAGCAATGG - Intergenic
986616711 5:9624821-9624843 CCTCTCTCCCTCCCATGGATCGG - Intergenic
987456174 5:18149889-18149911 ATTCACTTGCTCCCAAGGAAAGG - Intergenic
988527250 5:31998087-31998109 CATCTCAGCCTCCCAAGGGATGG + Intronic
991166397 5:63568703-63568725 CCCCTCTGGAACCCAAAGAATGG + Intergenic
991281853 5:64923403-64923425 CCTTAATGGCTCCTAAGGAAGGG - Intronic
992895340 5:81240375-81240397 ACCCTTTGTCTCCCAAGGAATGG - Intronic
994210197 5:97079314-97079336 CCCCTCTGCCTACCAAGAAAGGG - Intergenic
996029339 5:118687494-118687516 GCTCTCTTGCTCCCTAGCAAGGG + Intergenic
996413258 5:123181852-123181874 CCTCTCTGTCTGCCAGTGAAGGG + Intronic
996516147 5:124371920-124371942 CCTCTCCAGCTGCCAAGGCAAGG - Intergenic
996678367 5:126202440-126202462 GCTCTCTGGGTCCCCAGGGAAGG + Intergenic
998730635 5:145071864-145071886 CCTCTCTTGATCACAAGGCAAGG + Intergenic
1000048737 5:157543998-157544020 CACCTCTGACTCCAAAGGAATGG + Intronic
1001110397 5:168891384-168891406 CGTCTCTGGCTCCCAGGGGAGGG - Intronic
1001400608 5:171444230-171444252 ACTCACTCGCTCCCCAGGAAAGG + Intronic
1001638484 5:173229363-173229385 CCTCCCTGGCGCCCTAGGCATGG + Intergenic
1002759587 6:191378-191400 CATCTCAGACCCCCAAGGAAGGG - Intergenic
1002968468 6:1990910-1990932 ACTCTCTGGCTGCCAAAAAATGG + Intronic
1003815259 6:9833057-9833079 CCTCTGGGGCTGCGAAGGAAGGG - Intronic
1004506838 6:16253752-16253774 CCTCTCTTGCTCCCCAAGCAAGG + Intronic
1006442643 6:34061772-34061794 CCTCTCTGGATCCCAGGGTGGGG + Intronic
1007735008 6:43976589-43976611 CAACTCTGGGTCCCTAGGAAAGG - Intergenic
1012584295 6:100903885-100903907 CCTCTCTGGATCTAAAGGCAAGG + Intergenic
1012716740 6:102683326-102683348 ATTCTCTGGCTCACAAGGAAAGG + Intergenic
1013734410 6:113208679-113208701 CCTCACTGTCTCACAAGCAAGGG + Intergenic
1013949050 6:115757269-115757291 CACCTCTGCCTCCCAAGTAATGG - Intergenic
1014022480 6:116606866-116606888 CCCCACTAGCTCCCAAGCAATGG + Intergenic
1016640694 6:146345592-146345614 CCTCTTTGAATCCCAAGCAATGG - Intronic
1016688467 6:146908095-146908117 CCTCTTTGGCCCCAAAAGAAAGG - Intergenic
1017017905 6:150116396-150116418 CTTCTCTGGCTCCCCAGGGCTGG + Intergenic
1017403451 6:154091106-154091128 GCTCTCTGGCTCCAAAGAAAAGG + Exonic
1018831797 6:167448949-167448971 CCTATCTGGACCCCATGGAAAGG - Intergenic
1021143325 7:17054020-17054042 CCTCTCCTCCTCCAAAGGAATGG + Intergenic
1021558065 7:21941874-21941896 CCTTTTTTGCCCCCAAGGAATGG - Intronic
1022952359 7:35351062-35351084 TCTCTCTCACTCCCATGGAAGGG + Intergenic
1022977765 7:35574781-35574803 TCTCTCTGTCTCCCCTGGAAAGG - Intergenic
1024524795 7:50338765-50338787 CCTCTCTTGCTGGCAAGGCAGGG + Intronic
1024672299 7:51607201-51607223 CCTCCCTGGCCACCAAGGACAGG - Intergenic
1024875260 7:54014948-54014970 CCTCTCTGTCTCTCTCGGAAAGG - Intergenic
1027894691 7:84025554-84025576 AACCTCTGGCTGCCAAGGAACGG + Intronic
1030443563 7:109620388-109620410 GCTCTATTGCTACCAAGGAAAGG - Intergenic
1031435148 7:121724385-121724407 CCTCTCCCCCTCCAAAGGAACGG - Intergenic
1032147274 7:129395474-129395496 CCTCTCCAGCTCTCCAGGAAGGG - Intronic
1034728473 7:153362659-153362681 CAGCTCTGCCTCCCAAGGAGTGG - Intergenic
1034992846 7:155559099-155559121 TCTCTCTGCCTCCCACGGATGGG - Intergenic
1035718352 8:1771213-1771235 TCTCTCTGGCCACCAAAGAACGG - Exonic
1036212371 8:6852878-6852900 CTTCTCTGGCTCCCTGGGATGGG - Intergenic
1036794078 8:11742913-11742935 CCCCTTTGGTTCCCAGGGAACGG + Intronic
1037477733 8:19273940-19273962 CCTCTCTTGCTCCCAGCCAACGG - Intergenic
1038033199 8:23662631-23662653 CCTCACGGGCCCCCAAGGATTGG - Intergenic
1039062349 8:33581729-33581751 CCTCTCTGGTTCCCAAGGACAGG + Intergenic
1039469346 8:37803716-37803738 CATCCCTGGCTCCCAGGAAAGGG - Intronic
1039590274 8:38740395-38740417 CTTCTCTGGCCCTCCAGGAATGG - Intronic
1039830465 8:41209657-41209679 ACTCCCTCACTCCCAAGGAAAGG - Intergenic
1040652319 8:49463202-49463224 CCCCTGTGGATTCCAAGGAAAGG + Intergenic
1042468832 8:69160159-69160181 CCCATCTGACTCCCAGGGAATGG - Intergenic
1042591867 8:70404025-70404047 CCTCTCGCGCCCCCGAGGAAGGG + Intergenic
1044590553 8:93910133-93910155 CACCTCTGCCTCCCAAGTAACGG + Intronic
1045432162 8:102124193-102124215 CCGCTCTGGCTCCCGAGAAGCGG + Intronic
1046892207 8:119434819-119434841 CCTTTGTGGCTCACTAGGAAAGG + Intergenic
1048351342 8:133619144-133619166 CCTCTCTGTCTCTCAGGGCATGG - Intergenic
1048572857 8:135669474-135669496 CACCTCTTGCACCCAAGGAAGGG + Intergenic
1049304432 8:141893459-141893481 CCACTCTGGATCCACAGGAAGGG - Intergenic
1049707070 8:144047929-144047951 CCTCTCTGGCTGGCAAGCACTGG - Intergenic
1050419717 9:5450684-5450706 CCTCTCTCCATCCCAAAGAAAGG - Intronic
1050647934 9:7742102-7742124 CTGCTCTGGGTCCCAAGGATGGG + Intergenic
1053183184 9:35991959-35991981 ACTCTGTGGCTCCCATGGCAAGG + Intergenic
1056926903 9:90843163-90843185 CCTCCCTGGCTCCCGAGGCCTGG - Intronic
1057049190 9:91909346-91909368 CCTCTCAGGCTCCCATGGTTTGG + Intronic
1058759607 9:108118297-108118319 CCTCCCTGTCTCCCAGGGACAGG - Intergenic
1060399640 9:123340713-123340735 CCCCTCCAGCCCCCAAGGAAAGG - Intergenic
1060574622 9:124679488-124679510 CCTCTTTGGCTCCCTACGGATGG - Intronic
1060775092 9:126367254-126367276 CCCCTCTTGCTCCCTAGGATGGG + Intronic
1061064054 9:128266467-128266489 CTCCTCAGGCTCTCAAGGAAAGG + Intronic
1061422934 9:130481965-130481987 CCGCGCTGGCTCCCAAGGGCAGG - Intronic
1061505515 9:131029691-131029713 TCCCTCTGACCCCCAAGGAAGGG + Intronic
1062003856 9:134229729-134229751 CCCCTCTGGCTCCCAGCGACTGG - Intergenic
1189328703 X:40129708-40129730 CCACTCCTGCTCCCAAGGAAAGG - Intronic
1189773678 X:44451140-44451162 TCACACTGGCTCCCCAGGAAGGG + Intergenic
1190308887 X:49102526-49102548 CTTCTCTGGCTCCCCACGCAGGG + Intergenic
1190760923 X:53437663-53437685 CATCTCTGAGACCCAAGGAAAGG - Intergenic
1191216081 X:57933534-57933556 CCTCACTAGCTCCGAAGAAAAGG - Intergenic
1191779668 X:64851944-64851966 TCTCTCTGTCTCTCAATGAATGG + Intergenic
1192784624 X:74324364-74324386 CCTTTCTTCCTCCCAAGAAAAGG - Intergenic
1195070933 X:101278698-101278720 GAGCTCTGGCTCCCAAGGAATGG + Intronic
1198975334 X:142329071-142329093 CCTCTCCAGATCCCAAGAAAGGG - Intergenic
1199799659 X:151236990-151237012 TCTCTATGGCTCCAATGGAAAGG - Intergenic