ID: 1075732866

View in Genome Browser
Species Human (GRCh38)
Location 10:124646693-124646715
Sequence CAGAGTTCACATAAGGGGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 131}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075732866_1075732873 16 Left 1075732866 10:124646693-124646715 CCAACCCCCTTATGTGAACTCTG 0: 1
1: 0
2: 2
3: 25
4: 131
Right 1075732873 10:124646732-124646754 AACTCATGAGCCTGCAATACTGG No data
1075732866_1075732875 18 Left 1075732866 10:124646693-124646715 CCAACCCCCTTATGTGAACTCTG 0: 1
1: 0
2: 2
3: 25
4: 131
Right 1075732875 10:124646734-124646756 CTCATGAGCCTGCAATACTGGGG No data
1075732866_1075732874 17 Left 1075732866 10:124646693-124646715 CCAACCCCCTTATGTGAACTCTG 0: 1
1: 0
2: 2
3: 25
4: 131
Right 1075732874 10:124646733-124646755 ACTCATGAGCCTGCAATACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075732866 Original CRISPR CAGAGTTCACATAAGGGGGT TGG (reversed) Intronic
901067549 1:6501534-6501556 CAGAGTTCCCAGCAGGTGGTTGG - Intronic
906689663 1:47784278-47784300 CTGAGTTCACATTTGGGGGCAGG + Intronic
908687457 1:66738024-66738046 CAGAGTCCAGAAAAAGGGGTGGG + Intronic
908813891 1:68011964-68011986 AAGACTTCACAGAAGGGGGTTGG - Intergenic
911418647 1:97610360-97610382 CACAGGTCACACAAGGGAGTCGG - Intronic
918619668 1:186588636-186588658 CAAAATTCACATAAGAGGCTGGG + Intergenic
919972580 1:202590674-202590696 AAGAGTCCACATAAGGGAGATGG + Exonic
922308707 1:224367743-224367765 CAGAGCTCACTTTAGGGCGTTGG - Intronic
922410128 1:225365467-225365489 CAGCTTTCACAGAAGTGGGTGGG + Intronic
1063313764 10:4982432-4982454 AAGAGTTCAAAAAAGGGAGTGGG - Exonic
1065383981 10:25115528-25115550 CAGATTTAACATGAGGGGGGCGG + Intergenic
1067057300 10:43059609-43059631 CAGGGGTCCCATAAGGGGGTGGG + Intergenic
1071439590 10:85678543-85678565 CAGAGACCACATGAGGGGATGGG - Intronic
1073962248 10:108945823-108945845 CACAGTTCACAGAAGGGTTTGGG + Intergenic
1074967364 10:118503232-118503254 CAATGTTTACATAAGGAGGTGGG - Intergenic
1075369343 10:121921772-121921794 CACAGTTCACAGAAGGGGGTGGG - Intronic
1075732866 10:124646693-124646715 CAGAGTTCACATAAGGGGGTTGG - Intronic
1075933917 10:126323468-126323490 CAGAGTTGCCAAAAGGAGGTAGG + Intronic
1078385304 11:10885859-10885881 CAGAGTTCACATCAAGGGCAGGG + Intergenic
1081037951 11:38173775-38173797 CACACTTCACAAAAGTGGGTGGG + Intergenic
1081538311 11:44011728-44011750 CAGAGCTCACATATGGGTGGTGG + Intergenic
1083097433 11:60266187-60266209 CAGAGTGCAGAGAATGGGGTGGG - Intergenic
1085512447 11:77095284-77095306 CTGAGCTCAGAGAAGGGGGTGGG - Intronic
1087032186 11:93716637-93716659 CACACTTCACAAAAGGGGGTGGG + Intronic
1087391059 11:97536267-97536289 AAGATTTCCCATAAGGGGATGGG - Intergenic
1087951490 11:104225951-104225973 TAGAGTTGTCATAATGGGGTTGG - Intergenic
1088166537 11:106944733-106944755 CAGAGTACTCACATGGGGGTTGG - Intronic
1089745932 11:120616731-120616753 CAGATTTCAGATATGGGAGTGGG + Intronic
1090344195 11:126054785-126054807 CAGAGTGCAAAGAAAGGGGTGGG + Intronic
1091937213 12:4443533-4443555 CAGAGGTGACCTATGGGGGTGGG + Intronic
1093959080 12:25252537-25252559 GAGAGTTCAGAGAAGAGGGTAGG - Intergenic
1096724562 12:53550711-53550733 AAGTGTTCACATAAGGGGTTGGG + Intronic
1097534726 12:60853914-60853936 CCAGGATCACATAAGGGGGTAGG - Intergenic
1099234100 12:80061654-80061676 CAGAGATCACATAAGCTTGTGGG + Intergenic
1101917159 12:108904568-108904590 TAGATTTCTCATAAGGGGCTGGG - Intergenic
1101988878 12:109468349-109468371 GAGTTTTCACATAAGCGGGTGGG - Intronic
1103380117 12:120487622-120487644 CACACTTCACAAAAGGGGGTGGG + Intronic
1103980338 12:124732963-124732985 CTGAGTTCCCAGAAGGTGGTCGG + Intergenic
1104355373 12:128080549-128080571 CTGGGTTCAGATAAGGGGTTGGG - Intergenic
1106229356 13:27809809-27809831 CAGAGTTCTCAGCAGGGGGTTGG + Intergenic
1107532057 13:41291570-41291592 ATGAGTTCAAATAAGGGAGTAGG - Intergenic
1109998006 13:70155005-70155027 CACACTTCACAAAAGGGGGTTGG - Intergenic
1111935277 13:94550875-94550897 CAGAGTTCAGAGAAGGGTTTGGG + Intergenic
1112429799 13:99341405-99341427 CAGAGTTTATATCAGGGGGGGGG + Intronic
1116145943 14:41069248-41069270 CAGATTTCTCATAAAGGGGGTGG + Intergenic
1117346483 14:54837913-54837935 CAGAGGTAACCTAAGGGGCTGGG + Intergenic
1120154862 14:81082438-81082460 CACATTTCACAAAAGGGGGTGGG - Intronic
1120746752 14:88159251-88159273 CAAAGTTCACCAAAGGGGATGGG - Intergenic
1122852789 14:104546037-104546059 CAGAGTTCACAACCAGGGGTGGG - Intronic
1124864739 15:33478088-33478110 CAGTGTCCACTTGAGGGGGTTGG + Intronic
1129131400 15:73500812-73500834 CAGAGTTCAGAGGAGGGAGTGGG - Intronic
1131074592 15:89487135-89487157 CAGGGTTCAGATGTGGGGGTGGG - Intronic
1133419983 16:5637855-5637877 CAGATTTCACCTAAGGCGGTAGG - Intergenic
1134030951 16:10991888-10991910 CAGAGTTCACAAGAGTGGCTTGG + Intronic
1134602709 16:15545982-15546004 CAGAGGTCAAAGAAGAGGGTGGG + Intronic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138230955 16:55335852-55335874 CTGAGTTCACATGAGTGTGTGGG - Intergenic
1143563452 17:7708353-7708375 CAGTGTTCACACCAGGGTGTGGG + Intronic
1145361136 17:22213486-22213508 CACACTTCAGAAAAGGGGGTGGG - Intergenic
1147377719 17:40032807-40032829 CAGAGTCCACAGAAGGGTGACGG - Intronic
1147561082 17:41509628-41509650 CACAGGTGACATGAGGGGGTTGG - Intergenic
1147841306 17:43373688-43373710 CATACTTCACAGAAGGTGGTGGG - Intergenic
1150127180 17:62644950-62644972 CAGTGTTCACAGAAGGGGAGGGG + Intronic
1151923483 17:77175351-77175373 CACACTTCACAGAAGGGGGTGGG + Intronic
1152846205 17:82601184-82601206 GAGAGTTCACATGAGAGCGTGGG + Intronic
1203165583 17_GL000205v2_random:89945-89967 CACACTTCACAAAAGGGGGTGGG + Intergenic
1153318989 18:3753057-3753079 GAAACTTTACATAAGGGGGTGGG + Intronic
1156164549 18:34402675-34402697 CAGACTTCACAAAAGGGTGATGG + Intergenic
1158275681 18:55764679-55764701 CAGAGTTTACATAAGGGATGGGG + Intergenic
1158279397 18:55804777-55804799 CAGAGCTCACATAAGGGCCAGGG - Intergenic
1159054806 18:63453085-63453107 CACACTTCATAGAAGGGGGTGGG - Intergenic
1161363847 19:3867688-3867710 CTGAGGTCAAATAAGAGGGTGGG - Intronic
1164404505 19:27931813-27931835 CACACTTCACAAAAGGGGGTAGG - Intergenic
1166246788 19:41533845-41533867 CACACTTCACAAAAGGGGGTGGG + Intergenic
1167496250 19:49820257-49820279 CACACTTCACAAAAGGGGGTGGG + Intronic
927132750 2:20074303-20074325 CACACTTCACAAAAGGGGGTGGG - Intergenic
930104070 2:47626470-47626492 TAGAGTTCTGATAAAGGGGTTGG + Intergenic
932651319 2:73560981-73561003 CACACTTCACAAAAGGGGATGGG + Intronic
933532774 2:83531413-83531435 CACACTTCACAAAAGGGGGTGGG - Intergenic
933857448 2:86429397-86429419 CAGAGCTCACCTCAGGGAGTGGG + Intergenic
937697956 2:124828900-124828922 CACAGCTTACATATGGGGGTGGG + Intronic
938729131 2:134132378-134132400 CAGAGCTCACATATGGAAGTAGG + Intronic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
945836328 2:214839749-214839771 CAGATTTCTCATAAATGGGTTGG - Intergenic
946192082 2:218012849-218012871 CAAAATTCACATATGGGAGTGGG + Intergenic
948074810 2:235157699-235157721 CAGAGTTGAGATAGGGGTGTGGG - Intergenic
949052856 2:241906396-241906418 CACACTTCACAAAAGGGGGTGGG + Intergenic
1170747711 20:19115512-19115534 CAGAGGTCCCAGAAGGGGGGAGG + Intergenic
1172194316 20:33081724-33081746 CAGAGTTCACATCGGGAGGCTGG + Intronic
1173084974 20:39907229-39907251 CAGAGTACACTTTAGGGGCTAGG - Intergenic
1176336024 21:5601033-5601055 CACATTTCACAAAAGGTGGTGGG - Intergenic
1176391733 21:6219915-6219937 CACATTTCACAAAAGGTGGTGGG + Intergenic
1176406171 21:6369134-6369156 CACACTTCACAAAAGGTGGTGGG - Intergenic
1176469686 21:7096259-7096281 CACATTTCACAAAAGGTGGTGGG - Intergenic
1176493247 21:7478037-7478059 CACATTTCACAAAAGGTGGTGGG - Intergenic
1176507395 21:7660346-7660368 CACATTTCACAAAAGGTGGTGGG + Intergenic
1177433328 21:21018962-21018984 CAGAATTCACATCACGTGGTTGG + Intronic
1177756605 21:25356182-25356204 CAAAGTTCACCTAAGGGGCTGGG + Intergenic
1178245141 21:30943339-30943361 TAGAGTGCATATAAGGGTGTGGG + Intergenic
1178677236 21:34641653-34641675 CACACTTTACAAAAGGGGGTGGG - Intergenic
1178792922 21:35716669-35716691 CAGAGGTCACTTCAGAGGGTAGG - Intronic
1183491548 22:38119336-38119358 CAGACTTCACAGATGGGGCTGGG + Intronic
950729286 3:14942737-14942759 CACAGTTAAAAAAAGGGGGTGGG + Intergenic
951918332 3:27825404-27825426 CTGAGTTCATATAAGGAGCTGGG - Intergenic
954129744 3:48554367-48554389 CAGGGTTCACAGCAGGGAGTGGG - Intronic
955681552 3:61506622-61506644 CAGAGATCACATAGTGAGGTAGG - Intergenic
956329772 3:68093383-68093405 CAGAGCTGAAATAAGGGGGATGG - Intronic
957562552 3:81841736-81841758 CACACTTCACATATGGGAGTTGG + Intergenic
959022209 3:101199946-101199968 TAGAGTTCACTTACTGGGGTAGG - Intergenic
959084191 3:101834101-101834123 CAGAGTGCAGATAAGGGGTGAGG + Intronic
959961291 3:112302325-112302347 CACACTTCACAAAACGGGGTGGG - Intergenic
960545502 3:118910085-118910107 CAGAGTCAACAGAAGTGGGTAGG - Intronic
961349114 3:126287748-126287770 CAGAGCTCACAGGAGGGGGCTGG - Intergenic
965850159 3:173013509-173013531 CACACTTTACAAAAGGGGGTGGG + Intronic
966786966 3:183630931-183630953 CAGAGTTCAGTTAATGTGGTTGG - Intergenic
981116669 4:140998757-140998779 CAGAGTTCACATGATGGTGCAGG - Intronic
986579680 5:9252317-9252339 CAGAGTTCAGATTACAGGGTGGG - Intronic
988009388 5:25463207-25463229 CAGAGATCACATAAGGGTGTAGG + Intergenic
988013069 5:25515631-25515653 CAGAGTTCACAACAGGGTTTGGG + Intergenic
988153508 5:27418354-27418376 CAGATTTCACATAAAGGATTGGG - Intergenic
992189520 5:74277353-74277375 CAGAGCTCAGATAAGGGTCTGGG + Intergenic
995367324 5:111377621-111377643 CAGAATTCTCCTAAGAGGGTGGG - Intronic
995554369 5:113312349-113312371 CAGAGTTCACATAGACTGGTGGG + Intronic
996192910 5:120567434-120567456 CAGAGTACACAGAGGGTGGTAGG + Intronic
1000272975 5:159704386-159704408 CAGAGTTCACATGAAGACGTGGG - Intergenic
1002600245 5:180350301-180350323 GAGATTTCACATAAGTAGGTGGG - Intronic
1003214009 6:4092299-4092321 CATACTTCATAAAAGGGGGTAGG - Intronic
1003545496 6:7054805-7054827 CAGAGATGAAATATGGGGGTAGG - Intergenic
1006888420 6:37401688-37401710 CACACTTCACAAAAGGGAGTGGG + Intergenic
1010032396 6:71284948-71284970 AAGAGTTCAGTTAAGGTGGTGGG + Intergenic
1010657367 6:78526890-78526912 CAGATGTGACATAATGGGGTGGG + Intergenic
1010657409 6:78527311-78527333 CAGATGTGACATAATGGGGTGGG + Intergenic
1015545645 6:134358502-134358524 AAGAGCTCACATAAGGGTGTTGG + Intergenic
1017020512 6:150136345-150136367 CAGAGTCCTCATAAGTGGATTGG - Intergenic
1019571711 7:1715907-1715929 CAGAGTTCAAAGTCGGGGGTAGG - Intronic
1022674099 7:32482277-32482299 CACACTTCACAAAAGGGGGTGGG - Intergenic
1030096845 7:105908013-105908035 CTGGGTTCAGAAAAGGGGGTAGG + Intronic
1032649661 7:133863881-133863903 CAGATTTCACAAAAGGCAGTGGG + Intronic
1032670466 7:134077629-134077651 CACACTTCACAAAAGGGGGTGGG + Intergenic
1032829079 7:135604136-135604158 CAGACTTCACATAAGGATTTTGG + Intronic
1033046897 7:137970578-137970600 GACAGTTCACAGAAGGGGGTGGG + Intronic
1039948334 8:42149081-42149103 AAGAGTTCACATAAGAGAGGAGG - Intergenic
1041247655 8:55904461-55904483 CTGAGTTCACATATGGGGTTAGG + Intronic
1044794198 8:95879893-95879915 CAGATTTCACAGAAGAGAGTTGG + Intergenic
1047398861 8:124529119-124529141 CACACTTCACAAAAGGGTGTGGG - Intronic
1050874962 9:10622970-10622992 CAGAGTTCTCATAAATGGGTTGG - Intergenic
1056513517 9:87328453-87328475 CAGGCATCACAGAAGGGGGTGGG + Intergenic
1060771091 9:126332707-126332729 GAGAGGGCACATAAAGGGGTGGG - Intronic
1062380396 9:136284179-136284201 CAGAGTCCACATGTGGGGGAAGG - Intronic
1203425614 Un_GL000195v1:33869-33891 CACATTTCACAAAAGGTGGTGGG + Intergenic
1186087191 X:6003211-6003233 CACACTTAACAAAAGGGGGTGGG + Intronic
1187144210 X:16622766-16622788 CAGAGGTGACAGAAAGGGGTAGG + Intronic
1187144693 X:16626767-16626789 CAGAGGTCACAGAAGGGGAAGGG - Intronic
1190535015 X:51417325-51417347 CACACTTTACAAAAGGGGGTGGG + Intergenic
1191731780 X:64344045-64344067 CAGAGTTAGCATAAGTGGGTGGG - Intronic
1192749891 X:73978542-73978564 CAGGTTTCAAATATGGGGGTGGG - Intergenic
1193292871 X:79797158-79797180 CACACTTCGCAAAAGGGGGTGGG - Intergenic
1195011639 X:100737916-100737938 GGGAGTTCACAGAATGGGGTAGG + Intergenic
1198019538 X:132644648-132644670 CTGAGTTCCCATAAGGTGCTGGG - Intronic