ID: 1075734354

View in Genome Browser
Species Human (GRCh38)
Location 10:124654834-124654856
Sequence CAGGGCGAGCAGAGGCACGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 279}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1075734354_1075734367 30 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734367 10:124654887-124654909 GAAGTCACACCAGGCCCCTCGGG No data
1075734354_1075734366 29 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734366 10:124654886-124654908 GGAAGTCACACCAGGCCCCTCGG No data
1075734354_1075734364 21 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734364 10:124654878-124654900 TCCATGGGGGAAGTCACACCAGG No data
1075734354_1075734363 8 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734363 10:124654865-124654887 TGGTCTAAGGAGCTCCATGGGGG No data
1075734354_1075734358 -5 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734358 10:124654852-124654874 CCCTGTCTGTGTCTGGTCTAAGG No data
1075734354_1075734361 6 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734361 10:124654863-124654885 TCTGGTCTAAGGAGCTCCATGGG No data
1075734354_1075734362 7 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734362 10:124654864-124654886 CTGGTCTAAGGAGCTCCATGGGG No data
1075734354_1075734360 5 Left 1075734354 10:124654834-124654856 CCGGCGTGCCTCTGCTCGCCCTG 0: 1
1: 0
2: 0
3: 23
4: 279
Right 1075734360 10:124654862-124654884 GTCTGGTCTAAGGAGCTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1075734354 Original CRISPR CAGGGCGAGCAGAGGCACGC CGG (reversed) Intronic
900494994 1:2972243-2972265 AAGGGCGAGCACAGCCACACAGG + Intergenic
900732144 1:4269075-4269097 CAGGGAGAGGAGAGGCAGCCAGG + Intergenic
900927799 1:5717127-5717149 CTGGGAGAGCAGATGCAGGCTGG + Intergenic
905240714 1:36579342-36579364 CTGAGGGAGCAGAGGCCCGCAGG - Intergenic
907407093 1:54260348-54260370 CAGGGCGAGCAGTGGGGCTCTGG + Intronic
907472199 1:54681088-54681110 CAGGCCAGGCAGAGGCACCCAGG + Intronic
907822803 1:57987725-57987747 GAGCGCCAGCAGAGGCAGGCAGG - Intronic
910208288 1:84769561-84769583 CAGGGCAAGCAGAGTAAAGCTGG - Intergenic
910680067 1:89853872-89853894 GAGAGCGAGCAGATACACGCGGG + Intronic
912271120 1:108209737-108209759 GAGGGCTAGCAGAAGCACGGTGG - Intergenic
915165681 1:153946599-153946621 CGGGGCGCGCGGAGGAACGCTGG - Exonic
916362788 1:163990127-163990149 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
917019293 1:170569019-170569041 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
920074605 1:203327243-203327265 CTGGGCGTGCAAAGGCAGGCAGG + Intergenic
922396719 1:225209845-225209867 AAGGGCGAGCAGAAGCAGGGTGG + Intronic
922571982 1:226639769-226639791 CAGGGCCAGTGGAGGCACCCAGG + Intronic
924778384 1:247126744-247126766 CTGGGCGGGCAGCGGCACCCCGG + Intronic
924783274 1:247171676-247171698 CTGGGCGGGCAGCGGCACCCCGG - Intronic
1062785091 10:257973-257995 CAGGGTGAGCAGAGGCTGGCTGG + Intergenic
1063957795 10:11282316-11282338 CAGGGAGAGGACAGGCACCCAGG + Intronic
1065231090 10:23599084-23599106 GAGGGCGAGCTGAGGCAGGGCGG - Intergenic
1066159578 10:32714246-32714268 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1070279399 10:75037803-75037825 CAGGGCCAGCAGAGGCACTTGGG - Intergenic
1070363740 10:75716008-75716030 CAGTGCTAGAAGAGGCATGCTGG + Intronic
1070656808 10:78277276-78277298 CAGGCAGAGCAGAGGCACCCAGG - Intergenic
1070701044 10:78601975-78601997 CAGTGCCAGGAGAGGCAGGCAGG - Intergenic
1070744282 10:78923468-78923490 CAGGGACAGCAGTGGCACGTGGG + Intergenic
1070976586 10:80610247-80610269 CAGGGTGAGCTGAGGGACACTGG - Intronic
1070999653 10:80817722-80817744 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1071604173 10:86973207-86973229 TCGGGGGAGCAGAGGCACACAGG - Intronic
1073122890 10:101132897-101132919 CAGGGCCAGCAGAGGAAGGCGGG - Intronic
1073419647 10:103414190-103414212 CAGGGCTACCACAGGCATGCTGG - Intronic
1075734354 10:124654834-124654856 CAGGGCGAGCAGAGGCACGCCGG - Intronic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076209323 10:128627773-128627795 CAGGGTCAGCAGGGGCACGCTGG + Intergenic
1076439580 10:130471890-130471912 CTGGGAGTGCAGAGCCACGCGGG + Intergenic
1076537185 10:131187190-131187212 CAGTGCCAGCAGAGGCACGTCGG + Intronic
1076731819 10:132442962-132442984 CAGGCAGAGCAGAGGCAAGAAGG - Intergenic
1077393938 11:2312052-2312074 CAGGGCAGGCAGAGCCAGGCAGG + Intronic
1077485001 11:2834597-2834619 CTGTGCGAGCAGAGGCAGGGAGG + Intronic
1078809509 11:14743856-14743878 GAGGGCGAGCAGATGCAGGGTGG - Intronic
1080965703 11:37211410-37211432 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081095042 11:38921610-38921632 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1081794845 11:45812073-45812095 CAGGGCCAGAGGAGCCACGCAGG - Exonic
1083319917 11:61839184-61839206 GAGGGCGAGCTGAGGCAGGCAGG - Intronic
1083353435 11:62047488-62047510 CTGGGTGAGCAGAGGCTCTCTGG - Intergenic
1083763224 11:64829958-64829980 CAGGGCAAAGAGACGCACGCTGG + Exonic
1084359557 11:68660683-68660705 CAGGGTGAGCAGAGGAAGGCAGG + Intergenic
1086913170 11:92496534-92496556 CAGGGGGAGAAGAGGCACATGGG - Intronic
1089309203 11:117546723-117546745 GAGGGGGTGCAGAGGCACGGTGG + Intronic
1089969258 11:122679226-122679248 CAGTGCGTGCATAGGCACGATGG + Intronic
1090386216 11:126358851-126358873 CTGGGCCAGCAGTGGCACCCAGG - Intronic
1091301505 11:134510783-134510805 CTGGGTGAGCAGGGGCAGGCAGG - Intergenic
1094486109 12:30926923-30926945 CCGGGCGGGCAGAGGGAAGCCGG + Intronic
1095230579 12:39734203-39734225 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1095356334 12:41280059-41280081 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1096491333 12:52014784-52014806 CACGGCGAGCAGAGGCCCGAAGG - Exonic
1097202883 12:57294655-57294677 GAGGCCAAGCAGAGGCAGGCTGG + Intronic
1101939452 12:109089234-109089256 GAGGGAGAGCAGAGGGACTCTGG - Intronic
1104581402 12:130013811-130013833 CAGGGCCAGGACGGGCACGCGGG + Intergenic
1104602294 12:130162152-130162174 GAGGGCGAGGAGAGGCGGGCGGG + Intergenic
1104951446 12:132442415-132442437 CTGGGAGTGCAGAGGAACGCGGG - Intergenic
1106003475 13:25747001-25747023 CAGAGGAAGCAGAGGCTCGCAGG - Intronic
1106230139 13:27815270-27815292 CAGGGAAAGGAGAGGCCCGCGGG - Intergenic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1109195846 13:59376967-59376989 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1109328575 13:60900180-60900202 GAGGGCGAGCAGAGGAAGGGTGG + Intergenic
1110019873 13:70457150-70457172 GAGGGCGAGCAGATGCAGGGTGG + Intergenic
1112156742 13:96825455-96825477 CGGGGAGAGCAGTGGCAGGCGGG + Intronic
1113641571 13:111961377-111961399 CAGGGCTGGCAGAAGCACACTGG - Intergenic
1115974491 14:38981488-38981510 GAGGGCGAGCAGAAGCAAGGTGG - Intergenic
1118516178 14:66530754-66530776 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1119719694 14:76882706-76882728 CAGGGGAAGCAGAAGCAGGCAGG - Intergenic
1119806047 14:77483012-77483034 CAGGTCCAGCAGATGCATGCTGG - Intronic
1119942506 14:78656406-78656428 CAGGGTGAGCAAAGGCATGGAGG + Intronic
1122286063 14:100653624-100653646 CAGGGTGAGAAGAGGCTCGCTGG - Intergenic
1123203546 14:106691484-106691506 CAGGACTAGCAGGGGCATGCAGG - Intergenic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1125553381 15:40564798-40564820 CAGGGCGTCCAGAACCACGCAGG + Exonic
1126462459 15:48928069-48928091 TAGGGCGAGCCGAGGGACGGAGG + Intronic
1128095030 15:64947597-64947619 TAGGGCGAGGAGAGGCAAGGTGG - Intronic
1131074654 15:89487347-89487369 CTGGGCCAGCAGAGCCACCCAGG - Intronic
1131512230 15:93055757-93055779 CAGGGTGAGCAGGGGCTCGACGG + Intronic
1132462105 16:60577-60599 CAGGGCAATGAGGGGCACGCAGG + Intronic
1132813851 16:1816746-1816768 CAGGGCGAGCTGGGCCACACTGG + Intronic
1133345321 16:5065965-5065987 GAGGGCGTGCAGAGGCAGTCTGG - Exonic
1133979343 16:10622050-10622072 CAGGGCGAGGCAAGGCAGGCAGG - Intergenic
1135134783 16:19879543-19879565 GAGGGCGAACACAGGCAGGCAGG + Intronic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1139655033 16:68382367-68382389 CAGGGCTGGCAGGGGCAGGCTGG + Intronic
1140824749 16:78695582-78695604 CAGAGAGAGCAGAGCCATGCTGG + Intronic
1142186962 16:88699218-88699240 CATGGCGTGCAGAGGCACGGGGG - Intronic
1142402973 16:89870693-89870715 AAGGGAGAGCAGAGGCAAGCAGG - Exonic
1142467485 17:144650-144672 CAGGGGCAGCACAGGCACTCGGG - Intergenic
1143658799 17:8312419-8312441 CATGGGGAGCAGAGGCGTGCAGG - Exonic
1144624558 17:16838152-16838174 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1144881870 17:18434569-18434591 CAGAGGGAGCAGAGCCAGGCAGG + Intergenic
1145150363 17:20509817-20509839 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1145786047 17:27594535-27594557 GAGGTCGAGCAGGTGCACGCAGG - Intronic
1146162294 17:30566459-30566481 CAGAGGGAGCAGAGCCAGGCAGG - Intergenic
1147587241 17:41659518-41659540 CAGGGGGAAGAGAGGCACCCTGG + Intergenic
1147762267 17:42806716-42806738 CAGGTCGAGCAGTGTCAGGCAGG - Exonic
1148688097 17:49512049-49512071 CAGGGTGAGCAGCGGCCCGCTGG + Exonic
1149168238 17:53779838-53779860 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1149509970 17:57232297-57232319 CAGGGTGAGGAGAGGCAGGATGG + Intergenic
1150271876 17:63872072-63872094 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150275425 17:63894972-63894994 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1150277556 17:63909661-63909683 CAGGGCCAGGAGAGGCACTGGGG + Intronic
1150278848 17:63917258-63917280 CAGGGCCAGGAGAGGCACTGGGG + Exonic
1152339300 17:79715585-79715607 CAGGGCGACCAGACGCTGGCTGG + Intergenic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1153230038 18:2926434-2926456 CAGGGGGAGCAGAGGCACCTGGG + Intronic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1156508220 18:37612640-37612662 CAGGGAGAGCAGAGACTTGCTGG + Intergenic
1157178952 18:45478279-45478301 TAGGGCGAGCAGAAGCAGGGTGG - Intronic
1158962975 18:62601666-62601688 CAGGGCGAGGAGAGGGCAGCTGG + Intergenic
1160239735 18:77114674-77114696 CGGGGAGGGCAGAGTCACGCAGG + Intronic
1160239775 18:77114853-77114875 CAGGGCGAGCAGTGGGCTGCAGG + Intronic
1160731906 19:645035-645057 CAGGGTGAGCAGAAGCTCTCGGG - Intergenic
1160906526 19:1454017-1454039 CAGGGCCAGCAGAGGGAGGCAGG + Intronic
1160914659 19:1490896-1490918 CAGGGCGAGGAGAGGCGTGGGGG - Exonic
1161128872 19:2576426-2576448 CAGGGCGGGCCGCGGCAGGCGGG + Intronic
1162028961 19:7909264-7909286 AAGAGCGAGCAGGGCCACGCTGG - Intronic
1162742697 19:12782678-12782700 CTGGGCGAGCGGAGGCGCGCAGG + Intronic
1163371523 19:16903831-16903853 CAAGGCCTGCAGAGCCACGCAGG + Exonic
1163674595 19:18649143-18649165 CAGGGCGAGCAGTGGCGCCACGG - Intronic
1163676530 19:18658119-18658141 GCGGGGGAGCAGGGGCACGCTGG + Intronic
1163702130 19:18791231-18791253 CAGGGTGAGCAGAAGAACGCAGG + Exonic
1164047622 19:21555931-21555953 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1164521820 19:28985416-28985438 CAGGGCGAGGAGAGGCCATCTGG + Intergenic
1165460266 19:35940102-35940124 CCTGGCGAGCAGGGGCAGGCGGG - Exonic
1168530937 19:57128061-57128083 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
926044982 2:9703726-9703748 CAGGGTGAGCAGAGCCAAGTGGG - Intergenic
926170410 2:10549630-10549652 GAAGGGGAGAAGAGGCACGCAGG + Intergenic
928600648 2:32900766-32900788 CAGGGTGAGCCGAGGCATGGAGG + Intergenic
928750564 2:34466362-34466384 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
930780799 2:55223636-55223658 GAGGGCGCGCGGAGGCTCGCGGG + Intronic
933896206 2:86812107-86812129 CAGGGGGAGCAGGGGCAGTCAGG - Intergenic
934664184 2:96158462-96158484 CAGGGAGAGCAGAGGCCCCATGG + Intergenic
937856840 2:126678487-126678509 CAGGCCGGCCAGAGGCACACTGG - Intronic
940528285 2:154844922-154844944 GAGGGCGAGCTGAAGCAGGCAGG - Intronic
940995069 2:160140399-160140421 CAGAGCAAGCAGAGGCATGGCGG + Intronic
941540267 2:166773478-166773500 GAGGGAGAGCAGAGGCGGGCTGG - Intergenic
943094803 2:183416464-183416486 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
944291952 2:198018077-198018099 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947418772 2:229922780-229922802 CGGGGAGAGCAGGGACACGCGGG - Intronic
1169006068 20:2207870-2207892 CAGGGCGAGCTGACCCAGGCTGG - Intergenic
1170229480 20:14028717-14028739 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1170532528 20:17308865-17308887 CAAGGAGAGCAGAGGCTCCCAGG + Intronic
1170585384 20:17730421-17730443 GAGGGAGAGCAGAGCCTCGCCGG - Intronic
1170856580 20:20061862-20061884 CTGGCCCAGGAGAGGCACGCAGG + Intronic
1174686916 20:52465099-52465121 CAGGGAAAGCAGAGACAAGCTGG - Intergenic
1174751125 20:53112201-53112223 CAGGGAGAGCAGAACCACACAGG + Intronic
1175125838 20:56750848-56750870 CGGGGTGAGCAGAGGGACACAGG - Intergenic
1175486466 20:59350310-59350332 TAGGGAGATCAGAGGCATGCGGG + Intergenic
1175844230 20:62050279-62050301 CATGGGGAGCAGAGCCAGGCCGG - Intronic
1176287296 21:5024849-5024871 CATGGAGAACAGAGGCAGGCAGG + Intronic
1178917056 21:36710844-36710866 GAGGGCGAGCAGAGGCCGCCTGG - Intronic
1179511946 21:41879174-41879196 CAGGGCGCGCCGGGGCTCGCGGG + Intronic
1179804296 21:43827094-43827116 CAGGGCGAGCAGAAGCAGCTGGG + Intergenic
1179869885 21:44238626-44238648 CATGGAGAACAGAGGCAGGCAGG - Intronic
1179962780 21:44779562-44779584 CAGGGGGAGCAGAGTAACCCAGG - Intronic
1180036881 21:45254688-45254710 AAGGGTGAACAGAGGCAGGCAGG + Intergenic
1180138570 21:45876945-45876967 CGGGGCAAGCAGTGGCACACAGG + Intronic
1180992263 22:19943777-19943799 CAAGGCCAGCAGGGGCACTCAGG + Intronic
1183083573 22:35472893-35472915 CAGCTCGAGCAGAGGCTGGCAGG - Intergenic
1183495846 22:38143303-38143325 CAGGGTGAGCAGAGGTGAGCAGG + Intronic
1183546171 22:38455688-38455710 CAGCGCGGGCAGAGGGAGGCGGG - Intergenic
1183645463 22:39123792-39123814 CAGGGGGTGCAGGGGCAGGCGGG + Intronic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
950262788 3:11554498-11554520 CAGGATGAGCAGAGGCTGGCTGG + Intronic
950707640 3:14792890-14792912 CAGGGAGAGCACAGGCATCCAGG - Intergenic
951145012 3:19216271-19216293 CAGTGCTAGCAGAGGCAGGCTGG + Intronic
951347322 3:21561441-21561463 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
951543821 3:23806600-23806622 CAGGGCGGCCAGAGGCAGGCAGG + Intronic
952451632 3:33439557-33439579 CAGGGCGAGCAGAGGCCTTTGGG + Intronic
953373877 3:42412548-42412570 CAGGGTGAGCAGAGGCCATCAGG - Intergenic
956882070 3:73520735-73520757 TAGGGGGAGCAGGGGCAAGCAGG + Intronic
957776415 3:84760854-84760876 CAGGGCAAGCAGAAGCAGGGTGG + Intergenic
959519210 3:107306588-107306610 CAGAGCGAGCACAGGCCTGCTGG - Intergenic
961827587 3:129606891-129606913 CAGGGCGGCCAGGGGCAGGCGGG - Intergenic
962634856 3:137319879-137319901 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
963741480 3:149086223-149086245 CAGGGAACGCAGAGGAACGCGGG + Intronic
966250997 3:177865570-177865592 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
968902417 4:3437937-3437959 GAGGGTGAGGAGGGGCACGCTGG + Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
971196536 4:24475606-24475628 CAGGGCCTGCAGAGGCATCCAGG + Intergenic
971749121 4:30623873-30623895 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
973774137 4:54230144-54230166 CGGGACAAGCAGAGGCGCGCGGG + Intronic
976015093 4:80542891-80542913 CAGGGGCAGCAGGGGCATGCAGG - Intronic
977080666 4:92523707-92523729 CAGGTTCAGCAGAGGGACGCAGG + Intronic
977979238 4:103303379-103303401 CAGGGCTAGCAGGAGCAAGCAGG + Intergenic
978078964 4:104568444-104568466 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
979668362 4:123336990-123337012 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980157718 4:129126815-129126837 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
980634009 4:135474256-135474278 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
983543207 4:168935121-168935143 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
985774329 5:1832921-1832943 CATGGCCAGGAGAGCCACGCTGG + Intergenic
986431347 5:7684035-7684057 CAATGCCAGTAGAGGCACGCTGG - Intronic
988402023 5:30775282-30775304 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
992828205 5:80569925-80569947 CAGGGCCAGCCGAGGGCCGCCGG - Intronic
993402602 5:87472475-87472497 AAGGGCGAGCAGAAGCAGGGCGG + Intergenic
993861801 5:93145380-93145402 AAGGGAGAGCAGAGGCAGACTGG - Intergenic
995263860 5:110136247-110136269 GAGGGTGAGCAGAAGCAGGCTGG - Intergenic
995464339 5:112435843-112435865 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
996280824 5:121727023-121727045 TAGGGCGAGCAGAAGCAGGTTGG - Intergenic
999684426 5:154089484-154089506 CAGGGCTAGCAGAGGGATCCAGG - Intronic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1001907414 5:175484479-175484501 CGGGGCCAGCAGGTGCACGCCGG + Intronic
1002322813 5:178385549-178385571 CAGGGAGAGCAGGGCCACCCCGG - Intronic
1003119011 6:3304883-3304905 CAGGGAGAGGAGAGGGATGCAGG + Intronic
1003715589 6:8642659-8642681 CAGGCAGAGAAGAGGCACACAGG - Intergenic
1003845717 6:10171822-10171844 CAGGGCCAGCAAGGGCTCGCCGG - Intronic
1003950531 6:11111536-11111558 CAGGGGGAGCAGAGCCACTGTGG + Intronic
1004431234 6:15545934-15545956 CAGGGCCAGCTCAGGCAGGCGGG + Intronic
1004627802 6:17393527-17393549 GAGGGAGAGCAAAGCCACGCGGG - Exonic
1005349914 6:24924061-24924083 CAGGCTGAGCAGACCCACGCTGG + Intronic
1006932606 6:37697040-37697062 CCGGGCGCGCCGAGGCACCCGGG - Exonic
1008568290 6:52790694-52790716 CAGGGCTAGCAAACGCACCCAGG + Intergenic
1008579689 6:52895648-52895670 CAGGGCTAGCAAATGCACCCAGG + Intronic
1008896920 6:56566493-56566515 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1009880428 6:69560310-69560332 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1011120005 6:83942319-83942341 GAGGGCGAGCAGAAGCATGGTGG + Intronic
1011760194 6:90555741-90555763 CATGGTGACCAGAGGCACACAGG - Intronic
1012870803 6:104670927-104670949 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1015313528 6:131791980-131792002 GAGGGAGAGTAGAGCCACGCAGG + Intergenic
1015533532 6:134244610-134244632 GAGGGCGAGCAGAAGCAGGTGGG - Intronic
1015544562 6:134348140-134348162 GAGGGAGAGCAGAGGCGGGCTGG + Intergenic
1015833063 6:137390150-137390172 CAGAGCAAGAAAAGGCACGCTGG - Intergenic
1017686506 6:156918803-156918825 CAGAGCGAGCGCAGGCAGGCTGG - Intronic
1018092710 6:160358836-160358858 CAGTCTGAGCAGAGGGACGCTGG + Intronic
1018872080 6:167791019-167791041 CTGGGAGAGCAGAGTCATGCGGG + Exonic
1019028694 6:168992265-168992287 CATGGGGTGCAGAGGCACACGGG - Intergenic
1019507366 7:1399056-1399078 CAGGGCCACCAGAGCCAGGCTGG + Intergenic
1019713582 7:2528481-2528503 CAGGGTCAGGAGAGGCACACAGG + Intronic
1019943360 7:4308366-4308388 CACGAGGAGCAGCGGCACGCCGG - Intergenic
1020250934 7:6467865-6467887 CAGGGAAAGAAGAGGCACTCAGG + Intronic
1022180788 7:27917306-27917328 GAGAGTGAGGAGAGGCACGCTGG - Intronic
1022858513 7:34340943-34340965 CAAGGAGAGCAGGGGCACCCAGG - Intergenic
1023705849 7:42941202-42941224 CGGGGCCAGCAGAGGAACACAGG - Intronic
1025638006 7:63340408-63340430 GAGGGCGAGCAGAAGCAGGTTGG - Intergenic
1025644690 7:63407691-63407713 GAGGGCGAGCAGAAGCAGGTTGG + Intergenic
1026166124 7:67911325-67911347 CAGTGCCAGCAGAGGCACCAAGG - Intergenic
1028991172 7:97050755-97050777 GAAGGCGAGCAGAGGCAGGGTGG + Intergenic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1030482225 7:110119552-110119574 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1031612570 7:123844996-123845018 GAGGGCGAGCTGAAGCAGGCGGG - Intronic
1031717379 7:125125515-125125537 GAGGGCGAGCAGAAGCAGGCTGG - Intergenic
1032638625 7:133739410-133739432 CAGGGAGAGCAGTGACAAGCTGG + Intronic
1032783883 7:135185694-135185716 CAGGGCCAGCAGAGCCAGGCTGG + Exonic
1033584470 7:142763789-142763811 CAGGGCCACCAGAGTCACCCTGG - Intronic
1034994567 7:155569936-155569958 CAGGGCCAGCGGAGGCACTGGGG + Intergenic
1035879901 8:3234657-3234679 CTGGGAGAGCAGAGGAAGGCAGG + Intronic
1036129807 8:6098563-6098585 CAGAGAGAGCAGAAGCACCCAGG - Intergenic
1036708464 8:11061932-11061954 CAGGGCCAGCCGAGGGACACAGG - Intronic
1037774590 8:21825027-21825049 CAGGGTGAGCTGAGGCTCGGAGG - Intergenic
1037894525 8:22642920-22642942 CAGTGCGGGCAGATGCACACAGG - Intronic
1038201073 8:25413217-25413239 CAGGCCTAGCAGAGGAAAGCAGG - Exonic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1041287222 8:56273386-56273408 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1042533334 8:69835476-69835498 CAGGAAGAACAGAGGCACGGGGG + Intergenic
1045254256 8:100506405-100506427 CAGGTAGAGCAGAGGCTCTCAGG - Intergenic
1045973258 8:108103627-108103649 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1048331011 8:133470843-133470865 CAGGGTGAGGTGAGGCACCCAGG - Intronic
1049090808 8:140512033-140512055 AAAGGCGCGCAGAGGAACGCGGG - Intronic
1049325222 8:142018051-142018073 GAGGGCAAGAAGAGGCAGGCAGG - Intergenic
1050750698 9:8933163-8933185 AAGGGCGAGCAGAAGCAGGGTGG - Intronic
1050963256 9:11765413-11765435 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1052901688 9:33799024-33799046 CAGGGCCACCAGAGTCACGCTGG - Exonic
1055061345 9:72072342-72072364 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1055353362 9:75412380-75412402 CAGGGTGGGCAGAGTCAGGCAGG + Intergenic
1055453499 9:76452594-76452616 CAGGGGGAGGAGAGGCAGGGAGG + Intronic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057294564 9:93827717-93827739 CAGAGAGGGCAGAGGCACGGTGG - Intergenic
1061514130 9:131078890-131078912 CAGGGCGAGAGGAGCCAGGCTGG - Intronic
1062362420 9:136194069-136194091 CAGTGCGGGCAAAGGCGCGCCGG - Intergenic
1186332833 X:8554292-8554314 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1186798167 X:13066694-13066716 CAGGAAGAGCAGAGGCACAGAGG - Intergenic
1187288810 X:17932292-17932314 CAGGGTGAGCAAAGGCTTGCTGG - Intergenic
1188130097 X:26420061-26420083 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1190505792 X:51125074-51125096 GAGGGCGAGCAGAAGCAGGGTGG + Intergenic
1191631868 X:63330871-63330893 GAGGGCGAGCCGAGGCAGGGTGG + Intergenic
1191792496 X:64985777-64985799 TATGGCAAGCAGAGGCATGCTGG + Intronic
1192712695 X:73607784-73607806 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1192712927 X:73610363-73610385 GAGAGCGAGCAGAAGCACGGTGG - Intronic
1192980292 X:76332183-76332205 GAGGGTGAGCAGAAGCAGGCTGG + Intergenic
1195345041 X:103941006-103941028 GAGGGCGAGCAGAAGCAGGGTGG - Intronic
1196960298 X:120993348-120993370 GAGGGCGAGCTGAAGCACGATGG - Intergenic
1197395676 X:125923625-125923647 GAGGGCGAGCAGAAGCAGGGTGG - Intergenic
1198062520 X:133061646-133061668 GAGGGCGAGCAGAAGCAGGGTGG + Intronic
1198680632 X:139178007-139178029 CAGGGCGAGCTGAAGCAGGGTGG - Intronic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199608591 X:149595318-149595340 CAGGCCGAGGAGAGGCAGGAAGG - Intergenic
1199630531 X:149774042-149774064 CAGGCCGAGGAGAGGCAGGAAGG + Intergenic
1199967282 X:152830884-152830906 CAGCGCGGGGAGGGGCACGCTGG + Intergenic
1200247348 X:154533231-154533253 CAGGGTGAGCAGAGCCAAGCAGG - Intronic
1200835570 Y:7728102-7728124 CAGGCCAAGCAGAGGCCCCCAGG - Intergenic
1201065770 Y:10092792-10092814 AAGGGGGAGCAGAGGCAGGGCGG + Intergenic